Healthy adiposity and extended lifespan in obese mice fed a diet supplemented with a polyphenol-rich plant extract

Effect of HF/HS feeding on plasma biological parameters

As shown in Fig. 2, HF/HS-fed mice displayed significantly higher plasma glucose (Fig. 2a) and cholesterol levels (Fig. 2b) than Std-fed mice, with no difference in plasma triglyceride concentrations (Fig. 2c). Most strikingly, significant amounts of cholesterol accumulated in large-sized high-density lipoproteins (HDL), which contained 3- to 4-fold more cholesterol in HF/HS-fed mice than in Std-fed mice 180 days after the initiation of the dietary intervention (Fig. 2d,e). In addition to hyperglycaemia and hypercholesterolaemia, HF/HS feeding also dramatically increased oxidative stress (as shown by approximately 2-fold higher plasma malondialdehyde (MDA) levels; Fig. 2f), lipid intolerance (as shown by 2-fold higher plasma total fatty acids (FA) levels; Fig. 2g) and endotoxaemia (as shown by 2-fold higher plasma 3-hydroxymyristate (3-OH C14:0) levels; Fig. 2h) compared to Std-fed mice.

Open in a separate window

Figure 2

Blood parameters are altered by the HF/HS diet. Plasma glucose (a), cholesterol (b) and triglyceride levels (c) were measured in mice fed either the chow diet (Std) or the high-fat/high sucrose diet (HF/HS), after 0, 3 and 6 months of supplementation. Data are presented as the means ± s.e.m. and were analysed using ANOVA; n = 20 (Std) and n = 20 (HF/HS) per time point. ***p < 0.001. The size distribution of the plasma HDL lipoproteins was assessed by using electrophoresis on Spiragel™ 1.5–25% in mice fed either the chow diet (Std) or the high-fat/high sucrose diet (HF/HS) after 90 (d) and 180 (e) days of supplementation. Data are presented as the means ± s.e.m. and were analysed using Student’s unpaired t-test; n = 20 (Std) and n = 19 (HF/HS) per time point. **p < 0.01 and ***p < 0.001. (f) Plasma MDA levels in mice fed either the chow diet (Std) or the high-fat/high sucrose diet (HF/HS) were measured after 180 days of supplementation. Data are presented as the means ± s.e.m. and were analysed Student’s unpaired t-test; n = 20 (Std) and n = 14 (HF/HS). ***p < 0.001. Plasma total fatty acid (g) and lipopolysaccharide (h) levels in mice fed either the chow diet (Std) or the high-fat/high sucrose diet (HF/HS) were assessed by LC-MS/MS after 180 days of supplementation. Data are presented as the means ± s.e.m. and were analysed by using the Mann-Whitney U-test; n = 20 (Std) and n = 20 (HF/HS). ***p < 0.001.

Characterization of the adipose tissue of obese mice

Lipid analyses revealed substantial differences in the adipose tissue composition of mice in the HF/HS and Std groups. Although the total fatty acid content per adipose tissue weight did not differ between mice fed the HF/HS and Std diets (Fig. 3a), the adipose tissue from HF/HS-fed mice contained more oxidized fatty acids (Fig. 3b,c), cholesterol, cholesterol oxides (Fig. 3d,e), and endotoxins (Fig. 3f) than the adipose tissue from Std-fed mice. A morphological analysis of hypertrophic adipose tissue in obese mice fed the HF/HS diet revealed enlarged adipocytes (Fig. 4a,d) surrounded by a greater number of infiltrating macrophages (Fig. 4d), accounting for a higher expression of macrophage markers (Fig. 4e) than in lean mice fed the Std diet.

Open in a separate window

Figure 3

Mice fed the HF/HS diet exhibit an accumulation of cholesterol and cholesterol/lipid oxides in eWAT. (a) eWAT total fatty acids in mice fed either the chow diet (Std) or the high-fat/high sucrose diet (HF/HS) for 180 days. Mann-Whitney U-test, n = 20 (Std) and n = 20 (HF/HS). HODEs (b) and HETEs (c) were measured by LC-MS/MS in eWAT from mice fed either the chow diet (Std) or the high-fat/high sucrose diet (HF/HS) diet for 180 days. Data are presented as the means ± s.e.m. and were analysed using multiple Student’s unpaired t-tests; n = 20 (Std) and n = 20 (HF/HS). ***p < 0.001. The levels of cholesterol (d) and 7-hydroxycholesterols (7-α-hydroxycholesterol, 7α-OH Chol and 7β-hydroxycholestrol, 7-β-OH Chol) (e) in the eWAT of mice fed either the Std or HF/HS diet were measured using GC/MS. Data are presented as the means ± s.e.m. and were analysed using multiple Student’s unpaired t-tests; n = 20 (Std) and n = 20 (HF/HS). **p < 0.01 and ***p < 0.001. (f) eWAT Lipopolysaccharide (LPS) levels in the eWAT of mice fed either the Std or HF/HS diet. Data are presented as the means ± s.e.m. and were analysed using multiple Student’s unpaired t-tests, n = 20 (Std) and n = 20 (HF/HS). ***p < 0.001.

Open in a separate window

Figure 4

Supplementation of the diet with PRPE reduces HF/HS-induced eWAT cholesterol accumulation and macrophage infiltration. (a) eWAT weight of mice fed either the Std, HF/HS or HF/HS + PRPE diet. Data are presented as the means ± s.e.m. and were analysed using the Kruskal-Wallis test with Dunn’s post hoc analysis; n = 20 animals in each diet group. **p < 0.01 and ***p < 0.001). (b) Frequency distribution of adipocyte sizes in eWAT from mice in the Std, HF/HS, and HF/HS + PRPE groups. (c) Mean adipocyte sizes (µm²) in mice from groups fed the Std, HF/HS or HF/HS + PRPE diet. Data are presented as the means ± s.e.m. and were analysed using the Kruskal-Wallis test with Dunn’s post hoc analysis; n = 10 mice per diet group. ***p < 0.001. (d) Immunohistochemical (IHC) detection of the macrophage-specific antigen F4/80 in eWAT from Std-, HF/HS- and HF/HS + PRPE-fed mice (20 × magnification, scale bar = 50 µm). Representative images are shown. IHC for F4/80 was quantified by counting F4/80-positive infiltrates in 5 different fields per sample from 2 different sections per sample. Data are presented as the means ± s.e.m. and were analysed using the Kruskal-Wallis test with Dunn’s post hoc analysis; n = 10 animals per diet group. **p < 0.01 and ***p < 0.001. (e) Relative mRNA expression levels of murine macrophage markers in mouse groups after 180 days of the diet intervention. 36B4 was used as a housekeeping gene to calculate the ΔCt. Data are presented as the mean fold changes ± s.e.m. calculated with the 2^−ΔΔCt method. Data were analysed using the Kruskal-Wallis test with Dunn’s post hoc analysis; n = 20 animals per diet group. *p < 0.05, **p < 0.01, and ***p < 0.001.

Polyphenol-rich plant extract extends the median lifespan of obese mice

Wild-type C57BL/6Rj male mice aged 8 to 12 weeks were fed the HF/HS diet supplemented with or without a polyphenol-rich plant extract (PRPE) containing 25% of polyphenols ad libitum (Table 1). As shown in Fig. 1a, supplementation of the HF/HS diet with 0.48% PRPE did not modify food intake, with similar daily energy intake values measured in the HF/HS and HF/HS + PRPE subgroups throughout the animals’ lifespans. Supplementation of the HF/HS diet with PRPE was associated with a slight but significantly slower body weight gain in the early phase than in mice fed the non-supplemented HF/HS diet (Fig. 1b). However, the mean maximal weight, which was achieved after 200 days, was identical in the HF/HS and HF/HS + PRPE groups (61.32 ± 1.19 and 60.02 ± 1.08 grams in obese mice fed the HF/HS diet and obese mice fed the HF/HS diet + PRPE, respectively; ns, Mann-Whitney U-test); similar results were obtained for the lean and fat mass percentages (Fig. 1c,d). After 600 days, elderly mice fed a diet supplemented with PRPE lost significantly more weight than elderly mice fed the HF/HS diet alone (Fig. 1b). Strikingly and despite the presence of similar obese traits at day 300, an analysis of survival curves revealed that PRPE supplementation markedly and significantly increased the lifespan, with median lifespan values of 689 and 381 days for obese mice fed the HF/HS diet supplemented with or without PRPE, respectively (p = 0.0418, Peto-Peto Prentice test; Fig. 1e,f).

PRPE improves plasma biological parameters

Supplementation of the HF/HS diet with PRPE resulted in significantly lower plasma cholesterol levels (Fig. 5a). The total, unesterified and esterified cholesterol contents of individual plasma lipoprotein fractions (i.e., very low-density lipoproteins (VLDL), low-density lipoproteins (LDL) and HDL fractions isolated by using gel permeation chromatography) were significantly lower in mice fed the diet supplemented with PRPE than in mice fed the non-supplemented diet, and the change was particularly prominent in the HDL fraction (Fig. 5b). Coincidently, the plasma HDL subfraction with the largest size (mean diameter greater than 12.9 nm, as determined using native gradient gel electrophoresis) was significantly less abundant after PRPE supplementation (Fig. 5c). Importantly, compared to HF/HS feeding, supplementation with PRPE produced a significant reduction in the levels of the oxidative stress marker MDA (Fig. 5d), a significant increase in the blood antioxidant defences (as evidenced by an extended KRL^TM half-life; Fig. 5e), and a significant decrease in endotoxaemia (Fig. 5g). Supplementation of the HF/HS diet with PRPE had no effect on plasma total fatty acid levels (Fig. 5f).

Open in a separate window

Figure 5

Supplementation of the HF/HS diet with PRPE normalizes blood parameters. (a) Total cholesterol levels in plasma from mice fed the HS/HS or HF/HS + PRPE diet ad libitum for 180 days were measured using GC/MS. Data are presented as the means ± s.e.m. and were analysed using the Mann-Whitney U-test; n = 19 (HF/HS) and n = 19 (HF/HS + PRPE). (b) FPLC-separated lipoprotein fractions from the sera of fasted HS/HS- or HF/HS + PRPE-fed mice were quantified by using electrospray ionization tandem mass spectrometry (ESI-MS/MS). Data are presented as the means ± s.e.m. and were analysed using multiple Student’s unpaired t-tests, n = 20 (HF/HS) and n = 20 (HF/HS + PRPE). *p < 0.05, **p < 0.01, and ***p < 0.001. (c) Size distributions of plasma HDL in mice fed either the HS/HS or HF/HS + PRPE diet for 180 days were assessed by using electrophoresis on a 1.5–25% Spiragel™. Data are presented as the means ± s.e.m. and were analysed by using Student’s unpaired t-test, n = 20 (HF/HS) and n = 20 (HF/HS + PRPE). ***p < 0.001. (d) MDA plasma levels in mice from each group were measured after 180 days of the dietary intervention. Data are presented as the means ± s.e.m. and were analysed using Student’s unpaired t-test; n = 20 (HF/HS) and n = 20 (HF/HS + PRPE). ***p < 0.001. (e) Total antioxidant activity was assessed in blood from mice fed either the HF/HS or the HF/HS + PRPE diet for 180 days. Data are presented as the means ± s.e.m. and were analysed by using Student’s t-test, n = 14 (HF/HS) and n = 18 (HF/HS + PRPE). Plasma total fatty acid (f) and lipopolysaccharide (g) levels in mice from each group were assessed by using LC-MS/MS after 180 days of supplementation. Data are presented as the means ± s.e.m. and were analysed using the Mann-Whitney U-test; n = 20 (HF/HS) and n = 20 (HF/HS + PRPE). *p < 0.05 and ***p < 0.001.

The beneficial effects of PRPE do not affect the fatty acid composition

Although the total fatty acid and oxidized fatty acid contents per adipose tissue weight did not differ when the HF/HS diet was supplemented with or without PRPE (Fig. 6a–c), the adipose tissue from mice fed the HF/HS diet supplemented with PRPE contained lower levels of endotoxins (Fig. 6d), cholesterol and cholesterol oxides (Fig. 6f, upper panels). Caloric restriction (CR) in obese mice from days 180 to 300 markedly reduced the body weight in a similar manner, regardless of whether the diet was supplemented with PRPE (Fig. 6e). After 120 days of caloric restriction (day 300), the levels of cholesterol and cholesterol oxides (per gram of adipose tissue) in the adipose tissue of non-supplemented mice were significantly decreased as the body weight was reduced by 30% (Fig. 6f, lower panels). In non-supplemented obese mice, the levels of cholesterol and cholesterol oxides were substantially reduced after body weight loss and no longer differed from the levels measured in PRPE-supplemented obese mice (Fig. 6f). In PRPE-supplemented mice, the low cholesterol and cholesterol oxide contents in the adipose tissue were independent of caloric restriction and weight (Fig. 6e,f). Based on these data, excess cholesterol and cholesterol oxide levels in HF/HS-fed mice are only be mobilized during body weight loss. A morphological analysis of the hypertrophic adipose tissue of obese mice fed a diet supplemented with or without PRPE revealed that PRPE did not affect adipose tissue hypertrophy and the adipocyte size (Fig. 4a–c), but markedly reduced the number of infiltrating macrophages (Fig. 4d). Accordingly, the expression of adipocyte-specific genes, i.e., PPARγ, aP2, perilipin1 and adiponectin, did not change (not shown), whereas the expression of macrophage markers was markedly reduced by the PRPE treatment (Fig. 4e).

Open in a separate window

Figure 6

Mobilization of lipids in adipose tissues by caloric restriction. The levels of total fatty acids (a), HODEs (b) and HETEs (c) were measured in the eWAT from mice fed mice fed either the HF/HS or HF/HS + PRPE diet for 180 days by using LC-MS/MS. Data are presented as the means ± s.e.m. and were analysed using the Mann-Whitney U-test, n = 20 (HF/HS) and n = 20 (HF/HS + PRPE) for a) and multiple Student’s unpaired t-tests; n = 20 (Std) and n = 20 (HF/HS) for (b,c). (d) Lipopolysaccharide (LPS) levels in the eWAT of mice fed either the HF/HS or HF/HS + PRPE diet for 180 days. Data are presented as the means ± s.e.m. and were analysed using the Mann-Whitney U-test; n = 20 (HF/HS) and n = 20 (HF/HS + PRPE). *p < 0.05. (e) Caloric restriction (CR) protocol: mice were fed ad libitum for 180 days with either the HF/HS or HF/HS + PRPE diet, and then a 30% reduction in energy intake was performed for an additional 120 days. Changes in the body weight of mice in each group are shown. Data are presented as the means ± s.e.m. and were analysed by using one-way ANOVA, n = 20 (HF/HS) and n = 20 (HF/HS + PRPE). ***p < 0.001. (f) eWAT cholesterol and cholesterol oxide content was assessed by GC/MS in fasted mice fed the HF/HS or HF/HS + PRPE diet for 180 days (upper panel, before CR) and after 120 days of caloric restriction (lower panel, after CR). Data are presented as the means ± s.e.m. and were analysed by using the Mann-Whitney U-test; n = 20 (HF/HS) and n = 20 (HF/HS + PRPE) before and after CR. ***p < 0.001.

Diets

For all animal studies, mice (13 to 20 per group) were matched according to plasma insulin and cholesterol levels and body weight prior to beginning the dietary interventions. When mice were 8 to 10 weeks old, they were randomly assigned to receive one of the following diets (Research Diets): chow diet (Std, D01060501), high-fat/high-sucrose diet (HF/HS, D03062301) or high-fat/high-sucrose diet supplemented with a polyphenol-rich plant extract (HF/HS + PRPE, D10062602). A detailed description of the compositions of the diets is provided in Table 1.

For caloric restriction, eight- to 10-week-old C57BL/6Rj male mice (n = 80) were randomly assigned the HF/HS (n = 40) or the HF/HS + PRPE diet (n = 40). After 180 days of feeding on the diet ad libitum, mice were further subdivided into 2 subgroups (n = 20 mice per group) in which the diet was supplemented with or without the tested PRPE at 180 days of feeding. For the remaining two groups, daily energy food intake was reduced by 30% over a 120-day period.

Polyphenol-rich plant extract

Active XXS inside^® supplied by Lara-Spiral (21560 Couternon, France) includes antioxidant polyphenol-rich extracts from food plants (Asteraceae, Lactuca; Liliaceae, Allium cepa; Lamiaceae, Ajuga; and Verbenaceae, Lippia). XXS™ complies with regulations on food contaminants and banned and prohibited substances. The polyphenol-rich plant extract (PRPE) was analysed by using HPLC with an HPLC-200 (Perkin Elmer, Massachusetts, USA) coupled to a diode array detector. Separation was performed using a linear gradient on a Licrospher 100 RP-18 column (150 × 4.6 mm; 5 µm) (Merck, Massachusetts, USA) maintained at 27 °C. The quaternary pump was connected to mobile phases (A), consisting of pH 2.2 water containing trifluoroacetic acid, and (B), consisting of acetonitrile. The following gradient was used in the present study: 0–5 min, 0% B and 5–50 min, 0–55% B. Twenty microliters of samples were injected into the chromatograph and the flow rate was 1 mL/min. Simultaneous monitoring was performed at 280 and 345 nm. Based on the results, the PRPE contains 25 g of polyphenols/100 g of extract (w/w), including 10 g/100 g of flavonoids (quercetin, 3.4 g/100 g; and glycosylated quercetin, 5.1 g/100 g) and 15 g/100 g of hydroxycinnamic acids (chlorogenic acid, 0.5 g/100 g; chicoric acid, 5.1 g/100 g; and phenylpropanoid caffeic acid glycosides, 5.0 g/100 g).

Mouse sample handling

After a 4-h fast (each diet group at each experimental time point), mice were anaesthetized by isoflurane inhalation. A cardiac puncture was performed using a 25 G needle, and a minimum of 500 µL of blood were collected in a heparinized tube. Plasma was obtained by centrifuging blood samples (8000 rpm for 10 min). Plasma samples were aliquoted and stored at −80 °C until further analysis. The epididymal white adipose tissue (eWAT) was harvested from fasted mice, weighed, snap-frozen in liquid nitrogen and stored at −80 °C until further analysis. For immunohistochemical analyses, eWAT sections were prepared from freshly harvested tissues that had been fixed with 4% paraformaldehyde (VWR, Fontenay-sous-Bois, France) for 24 h before being embedded in paraffin.

RNA extraction and real-time quantitative PCR analysis

Epididymal white adipose tissue (eWAT) was harvested from fasted mice, weighed, immediately snap frozen (immersion in liquid nitrogen) and stored at −80 °C until further analysis. Total RNA was extracted from eWAT samples by using the RNeasy Lipid Tissue Mini kit (Qiagen, Courtaboeuf, France) according to the manufacturer’s instructions and included a DNase treatment step. RNA concentrations were quantified using the NanoDrop 1000 spectrophotometer (Thermo Scientific, Illkirch, France), and 500 ng of RNA were then reverse transcribed into cDNAs using M-MLV reverse transcriptase, random primers and RNaseOUT inhibitor (Invitrogen, Thermo Scientific, Illkirch, France). The expression of each cDNA was quantified by using real-time PCR with the Power SYBR Green PCR Master Mix (Applied Biosystems, Warrington, UK) on a Viia7 Real-Time PCR system (Applied Biosystems,Warrington, UK). Relative mRNA levels were determined by using the ΔΔCt method and normalized to the expression of the mouse 36B4 gene. The following primer sequences were used: m-Emr1 forward 5′-CTTTGGCTATGGGCTTCCAGTC-3′, reverse 5′-GCAAGGAGGACAGAGTTTATCGTG-3′; m-CD68 forward 5′-CCAATTCAGGGTGGAAGAAA-3′, reverse 5′-CTCGGGCTCTGATGTAGGTC-3′; m-CD11b forward 5′-GTTTGTTGAAGGCATTTCCC-3′, reverse 5′-ATTCGGTGATCCCTTGGATT-3′; m-Arg1 forward 5′-TGGCTTGCGAGACGTAGAC-3′, reverse 5′-GCTCAGGTGAATCGGCCTTTT-3′; m-Mcp1 forward 5′-CCCAATGAGTAGGCTGGAGA-3′, reverse 5′-TCTGGACCCATTCCTTCTTG-3′ and m-36B4 forward 5′-ATGGGTACAAGCGCGTCCTG-3′, reverse 5′- GCCTTGACCTTTTCAGTAAG -3′.

Lipidomic analyses by using mass spectrometry

Epididymal white adipose tissue and plasma were harvested from fasted mice, immediately snap frozen (immersion in liquid nitrogen) and stored at −80 °C until further analysis. Total lipids were extracted from eWAT (50–150 mg) by using the Bligh and Dyer method⁶¹. Briefly, tissues were first extracted with saline (500 µL) and chloroform/methanol 2/1 v/v (3750 µL) in 10-mL glass tubes for 1 h at room temperature on a rotary agitator (20 rpm). Chloroform (1.25 mL) was then added and the extraction proceeded for 1 h. Finally, water (1.75 ml) was added, providing two phases. After centrifugation (1500 g for 5 min), the lower organic phase was collected and stored at −20 °C.

Hydroxyoctadecadienoic acids (HODEs), hydroxyeicosatetraenoic acids (HETEs) and 7-hydroxycholesterols (7α and 7β) were quantified using the method described by Yoshida et al.⁶², with some modifications. Briefly, dried lipids from eWAT (equivalent to 25 mg of eWAT) or plasma samples (200 µL) were solubilized with MeOH (500 µL) containing butylated hydroxytoluene (50 mg/mL) and saline (200 µL). Each sample was spiked with an internal standard mixture containing 7α-hydroxycholesterol-d7 (200 ng), 7β-hydroxycholesterol-d7 (200 ng) (Avanti Polar Lipids, Alabaster, Alabama, USA), 13-HODE-d4 (80 ng), 9-HODE-d4 (40 ng) and 15-HETE-d8 (40 ng) (Cayman, Ann Arbor, Michigan, USA). Samples were then mixed with a NaBH₄/NaCl (5.25 g of NaCl at 9 g/L + 39.375 mg of NaBH₄) solution and incubated for 5 min at room temperature before saponification for 40 min at 40 °C with a MeOH/KOH (1 M) solution. Lipids were then extracted with 2 mL of acetic acid (10%, Sigma Aldrich) and 5 mL of CHCl₃/ethyl acetate (4/1, v/v) (Acros Organics, Fisher Scientific, Illkirch, France). After centrifugation, the organic phase was divided in two equal aliquots for the analyses of sterols and HODEs/HETEs, respectively.

Oxysterols were analysed by using GC-MS as described below. After solvent evaporation under a vacuum, sterols were further solubilized with 100 µL of a mixture of N,O-bis(trimethylsilyl)trifluoroacetamide (BSTFA) and trimethylcholorosilane (TMCS) (4/1, v/v) and incubated at 80 °C for 1 h. After evaporation, the residue was dissolved in 100 µL of hexane and one microliter was injected onto an HP-5MS 30 m x 250 µm column. The GC-MS analysis was conducted on a 6890 GC chromatograph equipped with an HP7683 injector and a 5973 C mass-selective detector (Agilent Technologies, Les Ulis, France) operating with an electronic impact mode source setup at 70 eV. The ions used for the analysis were: 7α- and 7β-hydroxycholesterol, 456.2 m/z and 7α- and 7β-hydroxycholesterol (d7), 463.2 m/z. Calibration curves were obtained using authentic standards (10–640 ng) extracted with the same method used for samples.

HODEs and HETEs were quantified using a 1290-LC 6490-QqQ system (Agilent Technologies, Les Ulis, France). Briefly, after evaporating the organic phase under a vacuum, lipids were solubilized with 100 µL of a 70/30 v/v methanol/water mixture and 4 µL were injected onto a Zorbax Eclipse Plus C18 column (2.1 × 100 mm, 1.8 µm column, Agilent Technologies, Les Ulis, France). Separation was achieved at a flow rate of 0.3 mL/min at 30 °C using the following linear gradient of 5 mM ammonium acetate (solvent A) and acetonitrile/methanol (95/5, v/v) (solvent B): 23% B for 6.5 min, up to 50% B in 8.5 min, up to 52% B in 3 min and maintained at 52% for 5 min. Data were acquired in negative multiple reaction monitoring (MRM) mode (source temperature: 200 °C, nebulizer gas flow rate: 15 L/min, sheath gas flow rate: 11 L/min, temperature: 250 °C, capillary: 3500 V, collision energy: 18 V and 10 V for HODEs and HETEs respectively). Transitions of 299.4 → 198.0, 295.0 → 195.2, 295.0 → 183.1, 295.2 → 170.9, 319 → 219.2, 319 → 167.2, 319 → 163.2, 319 → 155.2, 319 → 115.2 and 327.4 → 226.1 were used to quantify 13-HODE-d4, 13-HODE, (12 + 10)-HODE, 9-HODE, 15-HETE, 11-HETE, 12-HETE, 8-HETE, 5-HETE and 15-HETE-d8, respectively. Calibration curves were obtained using authentic standards (5–320 ng) extracted with the same method used for samples.

Total fatty acids analysis. Samples (20 µL of plasma or total lipids from an equivalent of 0.25 mg of eWAT) were analysed as previously described⁶³.

Total cholesterol analysis. Plasma (20 µL) or total lipids levels in an equivalent of 1.0 mg of eWAT were spiked with 10 µg and 1 µg of the internal standard epi-coprostanol, respectively, and analysed as previously described⁶³.

LPS concentrations analysis. The eWAT (30–50 mg) and plasma (50 µL) samples were first hydrolysed for 3 h at 90 °C with 300 µL of 8 M HCl to determine LPS concentrations. Thereafter, lipids were extracted with 600 µL of water and 5 mL of a hexane/ethylacetate mixture (2:3, v/v) (Thermo Fisher, Illkirch, France). After centrifugation, the hexanic phase was collected, further dried under a vacuum and then the residue was dissolved with 200 µL of EtOH (Thermo Fisher, Illkirch, France) and transferred to injection vials. After evaporation, samples were dissolved in 50 µL of EtOH before analysis by using LC-MS/MS. 3-OH C14:0 and 3-OH C13:0 (Matreya, Clinisciences, Nanterre, France) were used as external and internal standards, respectively. Fatty acids were separated using a QQQ 6490 triple quadruple mass spectrometer (Agilent Technologies, Les Ulis, France) equipped with a 50-mm Zorbax SBC18 column (Agilent Technologies, Les Ulis, France) set to 45 °C and with a JetStream ESI source in the negative mode (gas temperature: 290 °C, gas flow rate: 19 L/min, nebulizer: 20 psi, sheath gas temperature: 175 °C, sheath gas flow rate: 12 L/min, and capillary voltage: 2,000 V). Two microliters of each sample were injected. A 13-min elution gradient was established as follows: from 0 to 0.5 min, 55% of A (water, ammonium formate 5 mM, formic acid 0.1%) and 45% of B (acetonitrile/water (95/5, v/v), ammonium formate 5 mM, formic acid 0.1%); from 3 to 8 min, 100% of B; and from 8.10 to 13 min, 55% of A and 45% of B. The flow rate was maintained at 0.4 mL/min throughout the gradient elution process. The mass spectrometer was set in MRM mode. A calibration curve was constructed with increasing concentrations of the external standard 3-OH C14:0. 3-OH C14:0 levels in samples were quantified by calculating the 3-OH C14:0/3-OH C13:0 ratio by using the calibration curve.

Chromatograms were analysed with the Agilent MassHunter Workstation software, and calibration curves were created using authentic standards extracted with the same method used for samples.

Blood biochemical analyses

Fasting blood samples were collected from the mice in each group after 0, 1.5, 3 and 6 months of diet consumption via cardiac puncture into heparin-containing tubes. Plasma was separated by centrifugation and stored at −80 °C until further analysis. Plasma total glucose, cholesterol and triglyceride levels were quantified with enzymatic methods using a Konelab Prime 30i diagnostic system (Thermo Scientific, Illkirch, France) and the reagents and instructions provided by the manufacturer. The size distributions of plasma lipoproteins, particularly the HDL subfraction, were analysed as previously described⁶⁴. Briefly, the size distributions of plasma lipoprotein subfractions were determined using non-denaturing polyacrylamide gradient gel electrophoresis with SpiraGel™ (Spiral Laboratories, Couternon, France). A 1.5–25% gradient SpiraGel™ (82 × 82 × 2.6 mm) enables the simultaneous determination of the size distributions of both plasma LDL and HDL fractions. This high-resolution gel is capable of resolving HDL subfractions 3c (7.21–7.76), 3b (7.76–8.17 nm), 3a (8.17–8.77 nm), 2a (8.77–9.71 nm), 2b (9.71–12.9 nm), and an HDL subfraction with mean diameter greater than 12.9 nm. Solutions with a density of 1.21 were prepared by adding KBr, and lipoproteins were isolated by using ultracentrifugation (5.5 h at 100000 rpm). Plasma subfractionation was performed at 150 V for 10 h at 4–10 °C, followed by 180 V for 11 h (3 500 V.h), in Tris buffer (90 mM Tris HCl, 80 mM boric acid, and 3 mM EDTA, pH 8.3). After electrophoresis, gels were stained with a 0.04% Coomassie brilliant blue G-250 solution and destained. Densitometry was used to measure the peak diameter of HDL subfractions in scanned gels. Peak HDL particle diameters were determined from calibration curves of 1000/molecular diameter of standards (nm) using 2^nd order polynomial equations. Standards, including a High Molecular Weight kit (GE Healthcare Life Sciences, Little Chalfont, UK) and calibrated LDL (25.5 and 27.0 nm), were run on every gel.

Lipid contents of fast protein liquid chromatography (FPLC)-separated lipoprotein fractions were also quantified by using ESI-MS/MS at Synelvia SAS (Prologue Biotech, Labege, France).

Determination of overall antioxidant defences

The overall antioxidant defence potential was monitored in fresh EDTA-treated blood using the KRL™ biological test (Spiral Laboratories, Couternon, France). The principle of the KRL test is to subject whole blood or erythrocyte suspensions to a temperature-controlled free radical reaction. The KRL analysis was conducted according to the manufacturer’s recommendations. Briefly, blood samples were mixed with an isotonic saline solution to measure the levels of organic free radicals produced at 37°C following the thermal decomposition of a solution of 2,2′–azobis (2-amidinopropane) dihydrochloride (AAPH). Similar to physiological conditions, both extracellular and intracellular antioxidant defences contribute to maintaining the cell integrity until haemolysis. Erythrocyte resistance was recorded using a 96-well microplate reader by measuring the decrease in absorbance at 620 nm. The resistance of whole blood and red blood cells to free radical attack is presented as the time required to achieve 50% haemolysis (half-haemolysis time, T_1/2 in minutes)⁶⁵ (US patent n°s 5,135,850 A and 20060234329 A1).

Plasma malondialdehyde assay

The total MDA level in plasma was determined by using HPLC on an HPLC-200 (Perkin Elmer, Massachusetts, USA) with fluorimetric detection (515/553 nm) after the derivatization of MDA with 2-thiobarbituric acid (TBA) using the method described by Moselhy et al.⁶⁶. Briefly, plasma samples (250 µL) were shaken for 30 min in a boiling water bath in the presence of 800 µL of 0.44 M phosphoric acid, 100 µL of 0.05% butylated hydroxytoluene (BHT) in EtOH and 200 µL of 0.8% thiobarbituric acid. The TBA-MDA adduct was separated on a 4.6-mm reverse-phase Licrospher RP-8 250 column (Merck, Massachusetts, USA) and quantified by measuring the fluorescence (ex = 515 nm; em = 553 nm). The mobile phase was a mixture of acetonitrile and 0.05 M phosphate buffer, pH 6.8 (40:60) under isocratic conditions at 45 °C; the flow rate was 1.25 mL/min, and 20 µL of each sample were injected onto the column. MDA concentrations were determined from calibration curves prepared using 1,1,3,3-tetramethoxypropane.

EchoMRI

The body composition, which is presented as the percentage of fat mass and lean mass, was determined using EchoMRI (Echo Medical Systems, Houston, Texas, USA).

F4/80 immunostaining

Paraffin-embedded eWAT tissues were serially sectioned into 5 µm slices. Immunohistochemistry (IHC) was performed after deparaffinization, rehydration, and antigen retrieval by heating in 10 mM sodium citrate buffer (pH 6, 95 °C). Sections were then saturated in a 3% BSA solution containing 3% hydrogen peroxide to block endogenous peroxidase activity. After saturation, sections were incubated with a rat anti-mouse F4/80 antibody (1/100; AbD Serotec, MCA497) for 1 h at room temperature. Sections were further incubated with ImmPress anti-rat Ig (Vector Laboratories, MP7444). IHC staining in sections was visualized using a NovaRed revelation kit (Vector Lab, SK4800) and a Leica DM 6000 microscope (Leica Microsystems). Negative controls were performed by incubating sections without the primary antibody. All sections were counterstained with haematoxylin (Leica, 380156E). Positive F4/80 infiltrates were counted in 5 different fields per section and two different sections per group. Adipocyte size distribution frequencies and mean sizes were evaluated in stained sections.

mRNA sequencing analysis

For high-throughput mRNA sequencing (RNA-seq), total RNA was extracted from eWAT samples with the RNeasy Lipid Tissue Mini kit (Qiagen, Courtaboeuf, France) according to the manufacturer’s instructions and included a DNAse treatment step. RNA-seq was performed by the Platform of Transfer in Cancer Biology of the Georges-François Leclerc Center (Dijon, France). Briefly, mRNA was selected from 1 µg of total RNA with the NEBNext Poly(A) mRNA magnetic isolation module (NEB). The RNA-seq library was prepared with 100 ng of RNA depleted of rRNA with a NEBNext Ultra RNA library kit for Illumina sequencing according to the manufacturer’s instructions (New England BioLabs, Evry, France), and sequencing was performed on a NextSeq500 device (Illumina, San Diego, USA). The libraries were sequenced with pair-end 76-base pair “reads”. RNA-seq data were analysed for differentially expressed genes and transcripts using the TopHat and Cufflinks informatics procedures⁶⁷. An unsupervised hierarchical clustering analysis was performed using Gene Cluster 3.0 software and viewed with the Treeview viewer. Values were normalized and centred on the mean. Hierarchical clustering was performed with Euclidean distance measure and complete linkage analyses. Upregulated genes are shown in red and downregulated genes are shown in green. Genes that were significantly upregulated by at least 2-fold (FDR < 0.05) in mice fed the HF/HS diet compared to mice fed the standard chow and significantly downregulated by the PRPE formulation were further used for gene ontology and enrichment analyses using the Database for Annotation, Visualization, and Integrated Discovery (DAVID v.6.8) software. The threshold was set according to the modified Fisher Exact p-value (EASE score) ≤ 0.05.

The authors are grateful for the staff who cared for animals at the animal facility of the University of Bourgogne. The authors thank CellImap and Small Animal platforms for providing expert technical assistance, Philippe Durand for assessing the blood antioxidant defence capacity with the KRL™ biological test, Frederic Prost for analysing the size distributions of plasma lipoprotein subfractions using Spiragel™, and Christos Tsaconas for analysing plasma MDA levels. The authors also thank the American Journal Experts for English language editing. This study is part of VITALIM’SENIORS and SYMPPA (SYndrome Métaboliques PolyPhénols Actifs), two Integrated Projects funded by the European Union (FEDER), the French Government, Regional Council (Bourgogne-Franche-Comté), General Departmental Council (Yonne, Côte d’Or), Grand Dijon and Vitagora. This work was supported by grants from the University of Bourgogne Franche-Comté, the Institut National de la Santé et de la Recherche Médicale (INSERM), and by a French government grant managed by the French National Research Agency under the programme ‘Investissements d’Avenir’ with reference ANR-11-LABX-0021 (Lipstic Labex). We would like to thank SENAGRAL – Eurial Ultra Frais for providing additional funding and the partnership with the VITALIM’SENIORS and SYMPPA projects.