Hypothalamic mTORC2 is essential for metabolic health and longevity

2.2. Development of mice lacking Rictor in hypothalamic neurons

Mice lacking mTORC2 signaling in hypothalamic neurons were generated by crossing mice conditionally expressing Rictor to mice expressing Cre recombinase under the control of the Nkx2.1 promoter (Rictor^{Nkx2.1−/−}) (Shiota, Woo, Lindner, Shelton, & Magnuson, 2006; Xu, Tam, & Anderson, 2008). This promoter is active in most of the hypothalamic nuclei during early development, with the exception of the suprachiasmatic nucleus (Mieda, Hasegawa, Kessaris, & Sakurai, 2017; Ring & Zeltser, 2010; Xu et al., 2008). We verified deletion of Rictor in the hypothalamus by determining the expression of Rictor mRNA and RICTOR protein from both male and female mice (Figure ​(Figure1c–e1c–e and Figure S1c). mTORC2 activity was assessed by determining phosphorylation of the mTORC2 substrate AKT S473, as well as phosphorylation of mTOR itself at S2481, an autophosphorylation site associated with incorporation into mTORC2 (Copp, Manning, & Hunter, 2009). As expected, the phosphorylation of AKT S473 and mTOR S2481 was reduced in Rictor^{Nkx2.1−/−} mice. Brain size was normal in Rictor^{Nkx2.1−/−} mice with no gross abnormalities apparent (Figure S1d).

2.3. Early‐onset, lifelong increase in body weight and adiposity of Rictor^{Nkx2.1−/−} mice

We monitored the body weight and composition of Rictor^{Nkx2.1−/−} mice and their wild‐type littermates. We observed that mice lacking hypothalamic Rictor weighed more than their wild‐type littermates throughout their lifespan, a difference that was statistically significant up to 22 months of age in females and 26 months of age in males (Figure ​(Figure1f).1f). Periodic assessment of body composition demonstrated that in the aging cohort of Rictor^{Nkx2.1−/−} mice, both sexes had increases in fat mass (Figure ​(Figure1g)1g) and to a lesser extent, lean mass (Figure ​(Figure1h);1h); the overall effect was a lifelong increase in adiposity (Figure S1e,f).

To characterize the development of these body weight and composition phenotypes, we analyzed a second cohort of Rictor^{Nkx2.1−/−} mice and their wild‐type littermates from the time of weaning. Rictor^{Nkx2.1−/−} mice of both sexes tended to be lighter than littermate controls at weaning, an effect that was statistically significant in males, yet by 5–7 weeks of age Rictor^{Nkx2.1−/−} mice of both sexes weighed more than littermate controls (Figure ​(Figure2a,b).2a,b). Weight gain generally occurred over a distinct period with subsequent stabilization at a new set point relative to controls. Increased body weight in young Rictor^{Nkx2.1−/−} mice reflected an increase in fat mass without any change in lean mass (Figure ​(Figure2c,d).2c,d). Consistently, fat pads were heavier in Rictor^{Nkx2.1−/−} mice (Figure S2a,b), and larger lipid droplets and adipocyte hypertrophy were observed in brown and white adipose tissue, respectively (Figure ​(Figure22e).

Open in a separate window

Figure 2

Early onset of obesity in mice lacking Rictor in hypothalamic neurons. (a and b) The weights of (a) female and (b) male control and Rictor^{Nkx2.1−/−} mice were tracked from 3 to 8 weeks of age (n varies by time point and group, n = 4–31; Holm–Sidak test following two‐way ANOVA, * = p < .05, ** = p < .01). (c and d) Lean and fat mass in (c) 10‐wk‐old female mice (n = 5‐6/group; Holm–Sidak test following two‐way ANOVA, * = p < .05, ** = p < .01, *** = p < .001, solid lines indicate comparisons of fat mass and spotted lines indicate comparison of lean mass) and (d) 20‐ to 22‐week‐old male mice (n = 5‐9/group; t test, ** = p < .01). (e) H&E‐stained BAT and gonadal white adipose tissue from 24‐ to 26‐wk‐old chow fed male mice. (f) Plasma leptin levels of female and male Rictor^{Nkx2.1−/−} mice (n = 6–8 mice/group; Sidak test following two‐way ANOVA, * = p < .05, ** = p < .01, *** = p < .001, blue/pink stars indicate significant difference vs. male/female controls). (Corresponding body weight curve is represented in Figure ​Figure6a,6a, week four to nine on chow diet) (g) Fat mass (Left) and body weight (Right) of male control and Rictor^{Nkx2.1−/−} mice (n = 5–6 mice/group; Sidak test following two‐way ANOVA, * = p < .05, *** = p < .001). (h) Energy expenditure of 24‐ to 33‐wk‐old female and male mice; per mouse basis (n = 6 mice/group; Sidak test following two‐way ANOVA, * = p < .05). (i) Twenty‐four hour food intake of 24‐ to 33‐wk‐old female and male mice on normal chow (n = 6 mice/group; Sidak test following two‐way ANOVA, * = p < .05).The overall effect of either genotype (GT) and age (panels A, B, F, G), GT and feeding status (C) or GT and sex (panels H‐I), and the interaction represents the p‐value from a two‐way ANOVA. Error bars represent the SEM

Leptin is an adipose‐derived hormone that decreases food intake and promotes energy expenditure (Campbell et al., 2017; Chua et al., 1996; Halaas et al., 1995; Pelleymounter et al., 1995). Loss of leptin signaling is sufficient to cause drastic weight gain, whereas weight gain due to other mechanisms is associated with hyperleptinemia as a compensatory response. As Rictor^{Nkx2.1−/−} mice have increased adiposity, we determined leptin levels in knockouts and their wild‐type littermates. We observed that plasma leptin was significantly increased in Rictor^{Nkx2.1−/−} mice, as was leptin mRNA expression in adipose tissue (Figure ​(Figure2f2f and Figure S2c). Intriguingly, the increase in plasma leptin was observed in Rictor^{Nkx2.1−/−} mice prior to a measurable increase in body weight or adipose mass (Figure ​(Figure2f,g),2f,g), and without obvious differences in adipocyte size (Figure S2d,e). Together, our results suggest that mTORC2 signaling in Nkx2.1 neurons may have primary effects on leptin expression independent of adipose mass.

2.4. Food intake and energy expenditure in Rictor^{Nkx2.1−/−} mice

We did not detect significant differences in body weight, respiratory exchange ratio (RER), food intake, or locomotor activity in 4‐week‐old Rictor^{Nkx2.1−/−} mice (Figure S2f–i). Although Rictor^{Nkx2.1−/−} mice displayed a slight decrease in energy expenditure on a per animal basis, the effect was not significant after correcting for the slightly lower body weight of the female Rictor^{Nkx2.1−/−} mice at this age, either by dividing energy expenditure by mass or by using ANCOVA (Figure S2j and Table S1). While no consistent change in food intake was detected during the period of body weight gain (Figure S2k), we did note a trend toward increased hyperphagia in male Rictor^{Nkx2.1−/−} mice upon refeeding (Figure S2l), indicating some dysregulation of the mechanism controlling satiety. In adult (24–33 week‐old) mice, body weight was higher in Rictor^{Nkx2.1−/−} mice of both sexes than in their wild‐type littermates (Figure S2m), while average energy expenditure per mouse and food intake were not affected by genotype in either gender (Figure ​(Figure2h,i).2h,i). Body mass adjusted energy expenditure (ANCOVA) was reduced in adult female Rictor^{Nkx2.1−/−} mice relative to their wild‐type littermates, which is consistent with their increased adiposity since adipose tissue consumes less energy per unit mass (Table S1). At ten months of age, opposite trends were observed in the energy expenditure between genders; total energy expenditure per mouse was slightly increased in females and slightly reduced in male Rictor^{Nkx2.1−/−} mice. The effect in females was absent after dividing energy expenditure by body weight, but remained marginally significant when adjusting by ANCOVA. Thus, energy expenditure is unchanged or increased in females, suggesting that food intake must explain the higher body weight. In contrast, the decreased energy expenditure in males occurs despite their larger size and unchanged food intake, suggesting that decreased calorie output might contribute to the maintenance of higher body mass in this sex (Figure S3a–c and Table S1). However, neither food intake nor daily energy expenditure were significantly changed in subsequent measures (at 18 months of age) from the same Rictor^{Nkx2.1−/−} mice, with or without adjustment for body weight by ANCOVA (Figure S4a–c and Table S1). Intriguingly, beam break analysis revealed decreased locomotor activity in 6‐ and 10‐month‐old Rictor^{Nkx2.1−/−} mice (Figure S5a–c), a phenotype that has not been previously associated with the mTORC2 signaling pathway.

2.5. Rictor^{Nkx2.1−/−} mice are hypoactive and exhibit reduced voluntary activity

To more definitively assess spontaneous locomotor activity in Rictor^{Nkx2.1−/−} mice in their home cage environment, we employed telemetry. We found that activity was robustly decreased in both sexes, although the effect was most pronounced in females (Figure ​(Figure3a–d),3a–d), owing in part to the fact that wild‐type females are considerably more active than their male counterparts. Fasting markedly increased locomotor activity, as expected (Yamanaka et al., 2003), but the decreased activity phenotype remained in Rictor^{Nkx2.1−/−} mice. Body weight and locomotor activity were not correlated in this experiment, suggesting that the phenotype was not secondary to changes in body weight per se (Figure S5d).

Open in a separate window

Figure 3

Voluntary home cage and running wheel activity but not goal‐oriented tasks is reduced in Rictor^{Nkx2.1−/−} mice. (a and b) Traces of average home cage activity of 13‐ to 14‐wk‐old female (a) and male (b) mice under the conditions indicated, as determined by telemetry with counts binned into 10‐min blocks. The overall effect of genotype (GT), time, and the interaction represents the p‐value from a two‐way RM ANOVA. (c and d) Quantification of the data in panels a and b; activity during the fed condition represents a two day average; during fasting and refeeding over ~24‐hr time period (n = 4–5 mice/group; Sidak test following two‐way ANOVA, * = p < .05, ** = p < .01, *** = p < .001). (e) Average distance run on a treadmill at exhaustion for 11‐wk‐old male and female mice (n = 4–10 mice/group, Sidak test following two‐way ANOVA, * = p < .05, ** = p < .01). (f) Eight‐month‐old control and Rictor^{Nkx2.1−/−} mice of both sexes were trained to press a lever to obtain food pellets. Pellets received prior to a 10‐min gap without earning a pellet (the “break point”) in a progressive ratio operant task conducted for one hour during the light period under fed and fasted conditions (1h PR) or during an overnight progressive ratio operant task under fed and fasted conditions (overnight PR). (n = 5–7 mice/group; Sidak test following two‐way ANOVA, * = p < .05). (g) Number of active lever presses during an overnight extinction paradigm where mice do not receive food pellets in response to lever presses (n = 5–7 mice/group; Sidak test following two‐way ANOVA, * = p < .05). (e–g) The overall effect of genotype (GT), sex, and the interaction represents the p‐value from a two‐way ANOVA. (h and i) Voluntary running wheel activity of 4‐month‐old male mice during (h) ad libitum feeding and (i) 24‐hr food deprivation. Data represented as revolutions per 10‐min bin. Inset, cumulative running wheel activity during the light and dark periods (n = 5‐8/group; Sidak test following two‐way RM ANOVA, * = p < .05, *** = p < .001). (h and i) The overall effect of genotype (GT), time, and the interaction represents the p‐value from a two‐way ANOVA. Error bars represent the SEM

A neural circuit involving the preoptic area and dorsomedial hypothalamus was recently shown to influence both physical activity and core body temperature (Zhao et al., 2017), and mice lacking Rictor in the whole brain have decreased core body temperature (Kocalis et al., 2014). Using implanted telemetry probes, we observed a subtle but consistent reduction in core body temperature in ad libitum fed female Rictor^{Nkx2.1−/−} mice during the middle of the dark period, with a similar tendency that did not reach statistical significance in males (Figure S6a–d).

In rodents, locomotor activity can be categorized as spontaneous (e.g., voluntary activity or exploration) or motivated (e.g., food seeking). To first establish that the decreased locomotor activity in Rictor^{Nkx2.1−/−} mice was not due to motor deficits, we tested running using an accelerating treadmill protocol (Frederick et al., 2015). Both sexes of Rictor^{Nkx2.1−/−} mice were able to run (Figure ​(Figure3e),3e), exhibiting activity levels far in excess of spontaneous home cage movement (Majdak et al., 2016; Zombeck, Deyoung, Brzezinska, & Rhodes, 2011). We observed an overall effect of genotype on the total distance run at exhaustion, with a small but significant reduction for female Rictor^{Nkx2.1−/−} mice (Figure ​(Figure3e).3e). This small effect is not consistent with a major motor deficit, and may be attributable to the increased body weight of mice lacking hypothalamic Rictor, and/or their decreased habitual level of activity.

To address the possibility of altered food seeking behavior in Rictor^{Nkx2.1−/−} mice, we assessed their motivation to obtain food. Mice were trained to press a lever to obtain a food pellet, then subjected to a progressive ratio (PR) schedule of reinforcement, where the number of lever presses required to obtain each food pellet increased exponentially (Alhadeff & Grill, 2014; Betley et al., 2015). Break point analysis (number of pellets received prior to a 10‐min break in lever pressing) revealed that control and Rictor^{Nkx2.1−/−} mice are equally motivated to obtain food under both fed and fasted conditions in this operant task, whether assessed for one hour during the light period or overnight during the dark period (Figure ​(Figure3f).3f). Next, we determined the willingness of Rictor^{Nkx2.1−/−}mice to press the lever in the absence of a food pellet reward (extinction) and observed no significant effects (Figure ​(Figure3g).3g). Together, these data indicate that Rictor^{Nkx2.1−/−} mice have no change in motivation to obtain food, which suggests that goal‐oriented activity is retained in Rictor^{Nkx2.1−/−} mice despite altered basal activity (Krashes et al., 2011). We next placed running wheels in home cages to assess the intrinsic motivation of Rictor^{Nkx2.1−/−} mice toward physical activity. Rictor^{Nkx2.1−/−} mice exhibited a major decrease in voluntary wheel running when fed ad libitum (Figure ​(Figure3h).3h). Upon food deprivation, running wheel activity was partly restored during the dark phase in Rictor^{Nkx2.1−/−} mice (Figure ​(Figure3i),3i), but the expected increase in activity during the light period relative to ad libitum fed mice was largely blunted (Krizo et al., 2018). These data support the conclusion that Rictor^{Nkx2.1−/−} mice have a reduced intrinsic drive to be physically active.

2.6. Assessment of endocrine, hormonal and neuropeptide changes in Rictor^{Nkx2.1−/−} mice

As Nkx2.1‐Cre has been shown to be active not only in the hypothalamus, but also in cells within the thyroid and pituitary (Xu et al., 2008), we next assessed whether Rictor^{Nkx2.1−/−} mice displayed changes in related pathways that might contribute to their growth and body weight phenotypes. Intriguingly, we found a significant increase in the circulating level of insulin‐like growth factor 1 (IGF‐1) in both sexes of Rictor^{Nkx2.1−/−} mice relative to their wild‐type littermates (Figure S7a). Consistent with increased growth hormone/IGF‐1 action, we observed a statistically significant increase in the femur lengths of female Rictor^{Nkx2.1−/−} mice (Figure S7b) as well as increases in the weights of lean tissues, including liver and skeletal muscle, in three‐month‐old mice (Figure S7c,d). In contrast, we found no significant differences in T4 or corticosterone levels between Rictor^{Nkx2.1−/−} knockouts and their littermate controls (Figure S7e,f). Thus, we consider it unlikely that the metabolic phenotypes we observe are a result of altered mTORC2 activity in the thyroid or changes in the hypothalamus–pituitary–adrenal axis, but increased IGF‐1 signaling may play a role in the increased lean mass. Notably, growth hormone/IGF‐1 signaling is normally associated with decreased adiposity (Bengtsson et al., 1993; Berryman, Glad, List, & Johannsson, 2013) and thus cannot explain the expanded adipose tissue mass in Rictor^{Nkx2.1−/−} mice.

The fact that Rictor^{Nkx2.1−/−} mice maintain increased adiposity despite high leptin is consistent with the possibility that they are leptin resistant. Since many leptin‐responsive neurons are located within the hypothalamus, one possibility is that mTORC2 is directly required downstream of leptin to suppress food intake. To test this possibility, we injected control and knockout mice with recombinant leptin and found that high‐dose leptin suppresses food intake and body weight in Rictor^{Nkx2.1−/−} mice (Figure S8a,b). We also observed similar levels of pSTAT3 in the hypothalamus of control and Rictor^{Nkx2.1−/−} mice (Figure S8c,d), suggesting that proximal leptin signaling is at normal levels. To further probe potential mechanisms underlying the dysregulated body weight in Rictor^{Nkx2.1−/−} mice, we examined the expression of hypothalamic neuropeptides. The orexigenic neuropeptide NPY was significantly increased in females, whereas the anorexigenic POMC and CART were reduced by ~50% and 25%, respectively, in males (Figure S8e,f). Thus, Rictor deletion in Nkx2.1‐expressing neurons altered the expression of several hypothalamic neuropeptides known to influence satiety and food intake.

2.7. mTORC2 signaling is essential for healthspan and lifespan

We next sought to determine the overall effect of hypothalamic Rictor deletion on health and longevity. Mice and humans become increasingly frail with age, and we applied a recently validated mouse frailty index that permits the quantification of the accumulating deficits that occur with age and predicts mortality risk (Kane et al., 2016; Rockwood et al., 2017; Whitehead et al., 2014). We observed that both female and male Rictor^{Nkx2.1−/−} mice develop significantly greater frailty than their control littermates (Figure ​(Figure4a,b).4a,b). As portended by this increased frailty, we find that loss of hypothalamic Rictor shortens the lifespan of both female and male mice (p = .005, log‐rank test stratified by genotype) (Figure ​(Figure4c).4c). Cox regression likewise indicated a significant negative effect of hypothalamic deletion of Rictor on survival (hazard rate (HR) = 1.69), and no interaction of genotype with sex was detected.

Open in a separate window

Figure 4

Hypothalamic mTORC2 signaling is essential for healthspan and lifespan. (a and b) Frailty was assessed longitudinally in (a) female and (b) male mice starting at 21 months of age (n = numbers vary month by month; 2–24 mice/group at each time point). (c) Kaplan–Meier plot showing the lifespan of female and male control and Rictor^{Nkx2.1−/−} mice. The overall effect of genotype (Rictor^{Nkx2.1−/−}) and sex (M) was determined using a Cox proportional hazards test (HR, hazard ratio). The table shows the median lifespan for each group, the percentage decrease in median lifespan for each sex, and the two‐tailed stratified log‐rank p‐value for the decrease in lifespan as a result of deletion of hypothalamic Rictor. Error bars represent the SEM

Genetic disruption of mTORC2 signaling in several key metabolic tissues, including adipose tissue, liver, pancreas, and skeletal muscle, is associated with disruption of glucose intolerance and insulin resistance (Bentzinger et al., 2008; Blair, Archer, & Hand, 2013; Kumar et al., 2008, 2010; Lamming, Demirkan, et al., 2014; Lamming, Mihaylova, et al., 2014; Lamming et al., 2012; Polak et al., 2008; Tang et al., 2016). We found that both male and female Rictor^{Nkx2.1−/−} mice exhibit lifelong mild glucose intolerance (statistically significant in males at all ages tested and in females only at 6 months of age, Figure ​Figure5a–c).5a–c). Insulin sensitivity of young Rictor^{Nkx2.1−/−} mice was similar to that of their littermate controls in both sexes (Figure ​(Figure5d,e).5d,e). However, Rictor^{Nkx2.1−/−} mice developed age‐related insulin resistance, an effect that was particularly prominent in males (Figure ​(Figure5f).5f). Collectively, these results demonstrate a critical role for hypothalamic mTORC2 in maintaining physiological and metabolic health with age.

Open in a separate window

Figure 5

Rictor^{Nkx2.1−/−} mice have lifelong impairment of glucose tolerance and develop insulin resistance. Metabolic health was assessed by performing (a–c) a fasting glucose tolerance test (GTT) and (d–f) a fasting insulin tolerance test (ITT) on both sexes of control and Rictor^{Nkx2.1−/−} mice at approximately (a and d) 3 months, (b and e) 6 months, and (c and f) 18 months of age. (a and d) n = 6–14 mice/group, 2–3 months of age; (b and e) n = 9–10 mice/group, 5–6 months of age; (c and f) n = 20–32 mice/group, 15–20 months of age. Area under the curve: the overall effect of genotype (GT), sex, and the interaction represents the p‐value from a two‐way ANOVA; * = p < .05 from a Sidak's post‐test examining the effect of parameters identified as significant in the two‐way ANOVA. Error bars represent the SEM

2.8. Loss of hypothalamic mTORC2 increases susceptibility to diet‐induced obesity

Deletion of Rictor in the whole brain or POMC neurons (Kocalis et al., 2014), or in Nkx2.1‐expressing neurons (this report), increases adiposity in male mice under chow feeding. However, the interactions of these genotypes with high calorie diets that are more relevant to current eating habits have not been investigated and no previous studies have included females. We therefore challenged Rictor^{Nkx2.1−/−} mice with a high‐fat, high‐sucrose (HFHS) diet. Both sexes lacking hypothalamic Rictor exhibited increased susceptibility to diet‐induced obesity, with significantly greater weight gain in females detectable even during the first week (Figure ​(Figure6a,b).6a,b). Adipose mass was significantly increased in Rictor^{Nkx2.1−/−} mice as compared to littermate controls fed the same HFHS diet (Figure S9a,b).

Open in a separate window

Figure 6

Rictor^{Nkx2.1−/−} mice have increased susceptibility to diet‐induced obesity. (a and b) The body weight of control and Rictor^{Nkx2.1−/−} mice of both sexes was tracked on chow diet and following a switch to a high‐fat, high‐sucrose (HFHS) diet as indicated, and (a) weight and (b) percentage weight gain on HFHS diet were plotted (n = 5‐12/group; Sidak test following two‐way ANOVA, * = p < .05, ** = p < .01, *** = p < .001). The overall effect of genotype (GT), time (T), and the interaction represents the p‐value from (a) a two‐way ANOVA or a (b) RM ANOVA. (c and d) Mice fed a HFHS diet for 3 weeks were fasted overnight and then refed for 4 hr, with collection of blood for the determination of (c) blood glucose and (d) insulin (n = 4–12 mice/group; Sidak's test following two‐way ANOVA, * = p < .05, **p = < .01). (e–i) Metabolic chambers were used to interrogate the metabolic effects of 1 week of HFHS diet feeding. (e) Body weight (f) spontaneous activity (g), energy expenditure per mouse (h) RER, and (i) average food intake during days 1–3 of HFHS feeding (n = 6 mice/group; Sidak's test following two‐way ANOVA, * = p < .05, ** = p < .01, *** = p < .001). (c–i) The overall effect of genotype (GT), sex, and the interaction represents the p‐value from a two‐way ANOVA. (j) Food intake (left) and body weight (right) of control and Rictor^{Nkx2.1−/−} mice of both sexes was tracked on a HFHS diet (n = 6 mice/group; Sidak's test following RM two‐way ANOVA, * = p < .05, ** = p < .01, *** = p < .001, blue/pink stars indicate significant difference vs. male/female controls). The overall effect of genotype (GT), time on diet (T), and the interaction represents the p‐value from a two‐way ANOVA. Error bars represent the SEM

We found that fasting blood glucose was significantly increased in both Rictor^{Nkx2.1−/−} males and females fed a HFHS diet (Figure 6c). Fasting and refed plasma insulin levels were increased in female Rictor^{Nkx2.1−/−} on HFHS diet (Figure ​(Figure6d).6d). Consistently, Rictor^{Nkx2.1−/−} mice fed a HFHS diet tended to have impaired glucose tolerance and insulin sensitivity as compared to littermate controls fed the same HFHS diet (Figures S9c–e). Plasma and liver triglycerides trended to increase in female Rictor^{Nkx2.1−/−} mice fed a chow diet (Figure S9f). Although there was no change in triglyceride levels in the plasma or livers of Rictor^{Nkx2.1−/−} mice of either sex on HFHS diet as compared to littermate controls, lipid content was elevated in the gastrocnemius muscles of female Rictor^{Nkx2.1−/−} mice (Figure S9g–i). Thus, the lack of mTORC2 signaling in Nkx2.1 neurons exacerbates body weight gain and the resulting impairment of glucose homeostasis when mice are exposed to an unhealthy diet.

5.2. Immunoblotting

For Western blots in Figure S1a, mice were fasted overnight and sacrificed approximately 16 hr later. Cells and tissue samples were lysed in cold RIPA buffer supplemented with phosphatase inhibitor and protease inhibitor cocktail tablets. Tissues were lysed in RIPA buffer as previously described (Arriola Apelo et al., 2016) using a FastPrep 24 (M.P. Biomedicals) with bead‐beating tubes and ceramic beads (Mo‐Bio Laboratories), and then centrifuged for 10 min at 17, 000 × g. Protein concentration was determined by Bradford (Pierce Biotechnology). 20 µg protein was separated by SDS–PAGE (sodium dodecyl sulfate–polyacrylamide gel electrophoresis) on 8%, 10%, or 16% resolving gels (Life Technologies/Thermo Fisher) and transferred to PVDF membrane and then immunoprobed as previously described (Baar et al., 2016). Imaging was performed using a GE ImageQuant LAS 4000 imaging station, and images were quantified using NIH ImageJ. Samples in which no total protein was detected were excluded from the analysis of both the phosphorylated and total protein. For immunoblots in Figure ​Figure1d,e,1d,e, and S1b whole cell lysates were prepared by homogenizing frozen tissue with RIPA lysis buffer supplemented with protease and phosphatase inhibitor cocktails (Roche) in TissueLyser (Qiagen). Twenty micrograms of whole cell lysate was run on 4%–15% gradient gel (Bio‐Rad) and transferred to PVDF membrane (Immobilon). Each blot was cut into maximum of three strips, blocked with 5% blotting blocker (Bio‐Rad), and probed with different primary antibodies (Rictor and phosphoproteins) at 1:2,000 dilution followed by secondary antibody incubation (1:5,000 dilution). Immunoblots were developed using SuperSignal West femto or pico kit (Thermo Fisher Scientific) on a Bio‐Rad Imaging System. Membranes were stripped and reprobed for total mTOR, Akt, and β‐actin.

5.3. Immunohistochemistry

C57BL/6J.Nia female mice were gravity perfused after an overnight fast (approximately 16 hr) through the left ventricle with 10% formalin for 15 min. Brains were removed, sliced in half in a sagittal plane on ice, and fixed in 10 ml 10% formalin overnight in 4°C. Subsequently, the tissue was transferred to 10 ml of 30% sucrose for 24–48 hr (until the tissue sank to the bottom of a 15 ml conical) at 4°C. Once fixed, the tissues were embedded in OCT compound and stored at −80°C until sectioning. Sectioning was done with a Lecia DM 4000B cryostat at 10 µm. Slides were washed with 1X PBS twice at RT. Blocking was done by incubating the slides in serum‐free blocking solution (Dako) for 30 min at RT. Slides were then washed three times with PBS. Primary antibodies targeting p‐Akt S473 (1:200 dilution) and NeuN (1:100 dilution) were used. Secondary antibodies targeting primary antibodies were conjugated with Alexa Fluor 488 (1:1,000 dilution) or Alexa Fluor 594 (1:1,000 dilution). DAPI (Thermo Scientific) was used to mount the slides and microscopy imaging was done using a Leica CM 1950. Images for each channel were obtained using a 20× objective, and scale bars were inserted manually by the investigator.

5.4. Metabolic studies

Multiple metabolic parameters including O₂, CO₂, food consumption, respiratory exchange ratio (RER), energy expenditure, and activity tracking were recorded using the Comprehensive Lab Animal Monitoring System (CLAMS, Columbus Instruments). For analysis of young 4‐week‐old female mice, mice were fed normal chow and housed in the metabolic chambers for 6 days. Data are represented as average values over the last 4 days. For longitudinal analysis of aging mice, mice were fed normal chow and acclimated to the metabolic chambers for approximately 24 hr prior to data collection, and data from a continuous 24 hr period were then selected for analysis as previously described (Yu et al., 2018). For analysis of diet‐induced obese mice, 6‐ to 8‐month‐old mice were singly housed for 4–7 days in home cages for acclimatization and then moved to the metabolic chambers and maintained for 6 days on normal chow, followed by a switch to HFHS diet for 7–8 days with ad libitum access to food and water. On normal chow, data for both male and female mice are represented as an average of 5 days (day 2 to day 6). For HFHS, data are represented as an average of all available days. For routine food intake measurements, mice were singly housed and food was weighed once or twice a week in the home cage.

5.5. Telemetry

Mice were implanted with telemetry transmitters (TA11PA‐F10, weight 1.6 g, Data Sciences International) in the peritoneal cavity for continuous monitoring of both core body temperature and home cage activity as described previously (Paschos et al., 2018; Yang et al., 2016). For telemetry monitoring, singly housed mice in home cages were placed in a ventilated, temperature‐controlled chamber with ad libitum access to food and water, with the exception of the indicated fasting period, during which they had access to water only.

5.6. Body composition

Body composition was measured by magnetic resonance imaging (EchoMRI, Echo Medical Systems).

5.7. Treadmill and running wheel

Treadmill performance was measured using an Exer3‐6 treadmill system (Columbus Instruments) as previously described (Frederick et al., 2015). Total distance run was defined as distance run before accumulation of 50 cumulative shock stimuli. Voluntary running was assessed using computer‐monitored running wheels (Columbus Instruments).

5.8. Frailty and longevity

Frailty and longevity were assessed in a total of 116 Rictor^{Nkx2.1−/−} mice and wild‐type (Rictor^fl/fl) littermates of both sexes (Table S2); two mice that died in close proximity to metabolic assessment were excluded from the analysis. Frailty was assessed longitudinally in a subset of mice starting at approximately 21 months of age using a 26‐item frailty index based on the procedures defined by Whitehead et al. (2014). The items scored included alopecia, loss of fur color, dermatitis, loss of whiskers, coat condition, tumors, distended abdomen, kyphosis, tail stiffening, gait disorders, tremor, body condition score, vestibular disturbance, cataracts, corneal opacity, eye discharge/swelling, microphthalmia, vision loss, menace reflex, nasal discharge, malocclusions, rectal prolapse, vaginal/uterine/penile prolapse, diarrhea, breathing rate/depth, and piloerection.

5.9. Operant task

The operant task experiment was performed in a conditioning chamber equipped with active (delivers food pellet) and inactive (does not deliver food pellet) levers as described previously (Alhadeff & Grill, 2014; Betley et al., 2015). Ad libitum fed mice were trained to perform the lever‐pressing task on a fixed ratio of one press per pellet (FR1) to obtain 20mg food pellets. This training was done overnight and followed sequentially by overnight training on FR3 and FR5 schedules. Following training, mice were tested on exponential progressive ratio (PR) schedule for either 1h during light period or overnight starting at dark period. The progressive ratio used followed the function of Fi = 5e^(0.2i) − 5, where Fi is the number of lever presses required to obtain the next pellet at i, the pellet number. Breakpoint analysis data are presented as number of pellets obtained before mice fail to press for a 10‐min period.

5.10. Determination of insulin and plasma metabolites

Plasma insulin was measured using mouse insulin ELISA kit (ALPCO) according to the manufacturer's instructions. Plasma and tissue triglycerides were measured using the Infinity Triglyceride Assay kit (Thermo Scientific; TR22421). Plasma free fatty acids were assayed using a free fatty acid (FFA) kit (Sigma‐Aldrich; MAK044) or HR Series NEFA‐HR(2) (Wako Diagnostics). Plasma leptin was measured using a leptin ELISA kit (EMD Millipore EZML‐82K). Plasma IGF‐1 was measured using a mouse IGF‐1 ELSIA kit (Crystal Chem, 80574). Plasma T4 (Cortez Diagnostics; 3149‐18) and corticosterone (Invitrogen; EIACORT) were measured using ELISA kits.

5.11. Glucose and insulin tolerance tests

Glucose tolerance tests were performed by fasting the mice overnight for 16 hr and then administering glucose (1 g/kg) intraperitoneally (Arriola Apelo et al., 2016; Fontana et al., 2016) or via oral gavage (2 g/kg). Insulin tolerance tests were performed by fasting mice for 5 hr or overnight for 16 hr, and then injecting human insulin intraperitoneally (0.75 IU/kg). Blood glucose was measured periodically for 2 hr after administration of dextrose or insulin using either a Bayer Contour blood glucose meter and test strips, or a OneTouch glucometer and test strips.

5.12. Gene expression

Total RNA was isolated from tissues using TRIzol reagent. RNA was reverse‐transcribed using High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific Cat# 4368814). qPCR was performed using an Applied Biosystems 7900HT system with SYBR green master mix (Applied Biosystems). Primer sequences used for qPCR were as follows: Rictor: F: ATGTGGCCAAATTGCAAGGAGTA, R: AACCCGGCTGCTCTTACTTCT; Actb: F: GGCTGTATTCCCCTCCATCG, R: CCAGTTGGTAACAATGCCATGT; Lep: F: CAGACAGAGCTGAGCACGAAA, R: CTGCACCCTATGTCACCATCA; Tbp: F: CCCCTTGTACCCTTCACCAAT, R: GAAGCTGCGGTACAATTCCAG. Pomc: F: CGCTCCTACTCTATGGAGCACTT, R: TCACCTACCAGCTCCCTCTTG; Agrp: F: AGGGCATCAGAAGGCCTGACCAGG, R: CATTGAAGAAGCGGCAGTAGCACGT; Npy: F: ACCAGGCAGAGATATGGCAAGA, R: GGACATTTTCTGTGCTTTCTCTCATTA; Cart F: CCCGAGCCCTGGACATCTA, R: GCTTCGATCTGCAACATAGCG; Hcrt: F: GCCGTCTCTACGAACTGTTGC, R: CGCTTTCCCAGAGTCAGGATA; and Lepr: F: AGCTAGGTGTAAACTGGGACA, R: GCAGAGGCGAATCATCTATGAC. Rictor and neuropeptide expression in the hypothalamus was normalized to Actb, and LepB expression in adipose tissues was normalized to Tbp.

We would like to thank all members of the Baur and Lamming laboratories as well as Dr. Craig Atwood and Dr. Rastafa Geddes for technical advice with respect to brain perfusion, cryosectioning, and immunostaining. We also thank the laboratory of Dr. Dawn Davis, and in particular Dr. Danielle Fontaine, for assistance in learning sectioning and immunostaining techniques. We thank A. Broman of the UW‐Madison Department of Biostatistics & Medical Informatics for assistance with analysis of lifespan data and R.