An ATM-SIRT6 axis underlies age-associated metabolic reprogramming

A-T patients lacking functional ATM display features of premature aging, accompanied by insulin resistance and glucose intolerance (Bar et al., 1978; Espach et al., 2015). Senescent cells exhibit impaired mitochondrial respiration, but enhanced glycolysis producing more lactate (Hagen et al., 1997; Lenaz et al., 2000). As such, we wondered whether ATM decline triggers an age-associated metabolic shift. Levels of glycolytic genes LDHB and PDK1 were dramatically increased in senescent MEFs and HSFs (Figure 2a and Figure 2—figure supplement 1a), and in liver tissues from Atm-/- mice (Figure 2—figure supplement 1b). Significantly, activating ATM via CQ suppressed senescence-associated glycolysis (Figure 2a and Figure 2—figure supplement 1a). Similarly, the inhibitory effect on glycolysis was diminished when ATM was depleted in HepG2 cells (Figure 2b). These data suggest a role for ATM in inhibiting glycolysis.

Open in a separate window

Figure 2.

ATM-SIRT6 axis regulates age-related metabolic reprogramming.

(a) Quantitative RT-PCR analysis of mRNA levels of indicated glycolytic genes in different passages of MEFs with or without treatment of CQ. Data represent means ± SEM. *p<0.05, **p<0.01, ***p<0.001. (b) Quantitative RT-PCR analysis of mRNA levels of indicated glycolytic genes in Scramble (NC), si-SIRT6 or si-ATM HepG2 cells incubated with or without CQ (10 μM, 6 hr). Data represent means ± SEM. *p<0.05, **p<0.01, ***p<0.001. (c) Heatmap representation of RNA-Seq data ({"type":"entrez-geo","attrs":{"text":"GSE109280","term_id":"109280"}}GSE109280) showing relative changes of glycolytic genes in Atm-/- MEF cells. The transcript levels are qualified in reads per kilobase of exon per million mapped sequence reads (RPKM), which is a normalized measure of exonic read density. Red and green indicate up- and downregulation, respectively. (d) Heatmap showing relative levels of metabolites in Atm+/+ and Atm-/- MEF cells of p53 null background, analyzed by LC-MS. Red and blue indicate up- and downregulation, respectively. (e) Immunoblots showing protein levels of H3K9ac and H3K56ac in ATM-deficient HepG2 cells. (f) Immunoblots showing levels of H3K9ac in A-T cells reconstituted with Flag-ATM. (g) ChIP analysis showing enrichment of H3K9ac at the promoter regions of indicated genes in Atm+/+ and Atm-/- MEFs. Data represent means ± SEM of three independent experiments. *p<0.05, **p<0.01, ***p<0.001. (h) ChIP analysis showing enrichment of Sirt6 at the promoter regions of indicated genes in Atm+/+ and Atm-/- MEFs. Data represent means ± SEM of six independent experiments. *p<0.05, **p<0.01, ***p<0.001. (i) Immunoblots showing protein levels of sirtuins in wild-type (WT) and ATM knockout (KO) HEK293 cells. (j) Kaplan-Meier survival of Atm-/- and Atm-/-;Sirt6-Tg male (n = 11 in each group) and female (n = 9 in each group) mice. **p<0.01. (k) Results of glucose tolerance tests in Atm+/+, Atm-/-, and Atm-/-;Sirt6-Tg mice. Data represent means ± SEM, n = 6. **p<0.01, ***p<0.001. (l) Results of insulin tolerance tests in Atm+/+, Atm-/-, and Atm-/-;Sirt6-Tg mice. Data represent means ± SEM, n = 6. **p<0.01. ‘ns’ indicates no significant difference.

Figure 2—source data 1.

Differently expressed mRNA profiles of Atm-/- MEF cells.

Click here to view.^{(1.3M, xlsx)}

Figure 2—source data 2.

Differentially expressed Metabolites in Atm KO MEFs.

Click here to view.^{(71K, xlsx)}

Figure 2—source data 3.

Differently expressed mRNA profiles of Sirt6-/- MEF cells.

Click here to view.^{(1.3M, xlsx)}

Figure 2—figure supplement 1.

Open in a separate window

Atm deficiency promotes glycolysis.

(a) Quantitative RT-PCR analysis of mRNA levels of indicated glycolytic genes in different passages of HSFs with or without treatment of CQ. Data represent means ± SEM. *p<0.05, **p<0.01, ***p<0.001. (b) Quantitative RT-PCR analysis of mRNA levels of glycolytic genes in liver tissues from Atm+/+, Atm+/-, and Atm-/- mice. Data represent mean ± SEM. Atm-/- Vs Atm+/+, *p<0.05, ***p<0.001. (c) Quantitative RT-PCR analysis of mRNA levels of glycolytic genes to validate the RNA-seq data set of Atm+/+ and Atm-/- MEFs. Data represent means ± SEM of six independent experiments. *p<0.05, **p<0.01, ***p<0.001. (d) Metabolic pathway enrichment in Atm null MEFs compared with wild-types. (e) AMP/ATP ratio and NAD + levels in wild-type and Atm null MEFs. (f) Immunoblots showing ATM and SIRT6 protein levels in indicated clones of ATM KO HEK293 cells generated by the CRISPR/Cas9 system. (g) Immunoblots showing protein levels of Sirt6 and H3K9ac in liver tissues from 4-month-old Atm+/+, Atm+/-, and Atm-/- mice. (h–i) Immunoblots showing SIRT6 levels in si-NC and si-ATM treated HepG2 and U2OS cells. (j) Quantitative RT-PCR analysis of sirtuin mRNA levels in wild-type and ATM KO HEK293 cells. Data represent means ± SEM.

Figure 2—figure supplement 2.

Open in a separate window

SIRT6 reduction underlies age-related metabolic reprogramming triggered by ATM decline.

(a) Heatmap representation of RNA-Seq data showing relative changes of glycolytic genes in Sirt6-/- MEF cells. Red and green indicate up- and downregulation, respectively. (b) Quantitative RT-PCR analysis of mRNA levels of glycolytic genes to validate the RNA-seq data set of Sirt6+/+ and Sirt6-/- MEFs. Data represent means ± SEM of six independent experiments. **p<0.01, ***p<0.001. (c) Quantitative RT-PCR analysis of mRNA levels of indicated glycolytic genes in HepG2 cells transfected with Scramble, si-ATM, si-SIRT6, or si-ATM plus Flag-SIRT6. Data represent means ± SEM. *p<0.05, **p<0.01, ***p<0.001. (d) Immunoblots showing protein levels of SIRT6 and H3K9ac in HepG2 cells treated with 10 μM CQ for indicated periods of time. (e) ChIP analysis showing enrichment of H3K9ac at promoter regions of glycolytic genes in HepG2 cells treated with 10 μM CQ for indicated periods of time. Data represent means ± SEM. *p<0.05, **p<0.01, ***p<0.001. (f) Immunoblots showing SIRT1, SIRT6, and SIRT7 protein levels in ATM knockdown (KD) or control HSFs. (g) Immunoblots showing protein levels of Atm, Sirt1, Sirt6 and γH2AX levels in Atm+/+ and Atm-/- primary MEF cells. (h) Immunoblots showing Sirt6 expression in liver tissues of Sirt6-tg mice. (i) Serum lactate levels in 3-month-old Atm+/+, Atm-/- and Atm-/-;Sirt6-tg male mice. Data represent mean ± SEM of five to six animals/group. *p<0.05.

To examine how ATM regulates glycolysis, we performed RNA-Seq in Atm-/- MEF cells, and revealed a significant upregulation of glycolytic pathways (Figure 2c, and Figure 2—source data 1). Specific genes were validated by q-PCR (Figure 2—figure supplement 1c). As p53 is critical in glycolysis (Kruiswijk et al., 2015; Schwartzenberg-Bar-Yoseph et al., 2004), we further analyzed metabolomics of Atm-/- and control MEFs in p53 null background. As shown, the metabolic profile exhibited a clear shift, i.e. mitochondrial electron transport chain and intermediates of TCA cycle were reduced, while intermediates of glycolysis were elevated (Figure 2d, Figure 2—figure supplement 1d–e and Figure 2—source data 2). The data suggest that ATM deficiency enhances anaerobic glycolysis in a p53-independent manner.

Sirt6 deacylase is able to shunt energy metabolism away from anaerobic glycolysis to the TCA cycle via H3K9ac-mediated local chromatin remodeling (Sebastián et al., 2012; Zhong et al., 2010). We noted that the level of H3K9ac was enhanced in cells depleted ATM (Figure 2e). Re-expressed ATM in A-T cells suppressed H3K9ac level (Figure 2f). ChIP analysis showed that H3K9ac was enriched at the promoter regions of glycolytic genes in Atm-/- cells (Figure 2g), where the relative occupancy of SIRT6 was abolished (Figure 2h). Consistent with increased H3K9ac, SIRT6 protein level was dramatically downregulated in Atm-/- mouse livers, and ATM-deficient HepG2, U2OS and HEK293 cells (Figure 2—figure supplement 1f–i). In contrast, protein levels of other sirtuins were not much affected in ATM KO HEK293 cells (Figure 2i), and mRNA levels of all sirtuins remained unchanged (Figure 2—figure supplement 1j). Moreover, transcriptomic analysis and q-PCR data illustrated that Sirt6 depletion upregulated a similar cluster of genes essential for glycolysis (Figure 2—figure supplement 2a–b and Figure 2—source data 3). More importantly, the hyper-activated glycolytic pathway caused by ATM deficiency was completely restored by ectopic SIRT6 in HepG2 cells (Figure 2—figure supplement 2c). The CQ treatment upregulated SIRT6 level and reduced H3K9ac level, especially at the regulatory regions of glycolytic genes (Figure 2—figure supplement 2d–e). Knocking down SIRT6 abolished the inhibitory effect of CQ on glycolysis (Figure 2b). Additionally, ATM depletion in HEK293 cells, HSFs, and MEFs, significantly downregulated SIRT6 protein level, with little effect on SIRT1 or SIRT7 (Figure 2i and Figure 2—figure supplement 2f–g). Thus, these data suggest that ATM decline triggers an age-associated metabolic shift via SIRT6-mediated chromatin remodeling.

Other than metabolic abnormality, depleting Sirt6 leads to premature aging features and shortened lifespan (Mostoslavsky et al., 2006a), whereas extra copies of Sirt6 promote longevity in male mice (Kanfi et al., 2012). Given that Sirt6 was destabilized in Atm null mice, we wondered whether the Sirt6 transgene could rescue premature aging phenotypes and shortened lifespan in Atm-/- mice. To this end, we generated Sirt6 transgenic mice by microinjection, and bred them with Atm-/- mice. The overexpression of Sirt6 was demonstrated by western blotting (Figure 2—figure supplement 2h). Significantly, ectopic Sirt6 restored the elevation of serum lactate, and extended lifespan of Atm-/- mice of both genders (Figure 2j and Figure 2—figure supplement 2i). Importantly, Atm-/-;Sirt6-tg mice exhibited improved glucose tolerance and decreased insulin resistance (Figure 2k–l). Given that little difference was observed in glucose metabolism between young wild-type (WT) and Sirt6-transgenic mice (Kanfi et al., 2012), these data suggest a contributory role of the Atm-Sirt6 axis in the age-associated metabolic reprogramming.

ATM phosphorylates and stabilizes SIRT6

Next, we examined how ATM regulates SIRT6. Significantly, overexpression of ATM increased SIRT6 level, but this was abolished when ATM was S1981A-mutated to block dimeric ATM dissociation (Bakkenist and Kastan, 2003; Berkovich et al., 2007) (Figure 3a). Moreover, in addition to CQ, hypotonic buffer (20 mM NaCl), low glucose (LG), DNA-damaging agent camptothecin (CPT), and doxorubicin (Dox) all activated ATM and concomitantly increased SIRT6 protein level (Figure 3—figure supplement 1a–c), which was abrogated in ATM-depleted cells (Figure 3—figure supplement 1b–c). These data implicate a direct regulation of SIRT6 stability by ATM kinase activity. To confirm this, we first performed co-immunoprecipitation (Co-IP) in cells transfected with various FLAG-sirtuins. Interestingly, ATM was predominantly associated with SIRT6 among seven sirtuins (Figure 3b). The interaction was further confirmed at both ectopic and endogenous levels (Figure 3c and Figure 3—figure supplement 1d). Immunofluorescence microscopy showed co-localization of SIRT6 and ATM protein in the nucleus (Figure 3d). A domain mapping experiment indicated that the C-terminal domain was required for SIRT6 binding to ATM (Figure 3—figure supplement 1e). To determine whether ATM physically binds to SIRT6, 10 consecutive recombinant GST-ATM proteins were obtained and the binding to purified His-SIRT6 was analyzed. As shown (Figure 3e), His-SIRT6 bound predominantly to GST-ATM-4 (residues 770–1102) and relatively weakly to GST-ATM-1 (residues 1–250); both belong to the N-terminal HEAT repeat domain of ATM.

Open in a separate window

Figure 3.

ATM interacts with and phosphorylates SIRT6.

(a) Immunoblots showing protein levels of SIRT6 in HEK293 cells expressing Flag-ATM or Flag-ATM S1981A. (b) Immunoblots showing endogenous ATM and p-S/TQ motif in anti-Flag immunoprecipitates in HEK293 cells transfected with empty vector or Flag-sirtuins. (c) Immunoblots showing Flag-ATM and HA-SIRT6 in anti-HA (upper) or anti-Flag (lower) immunoprecipitates in HEK293 cells transfected with indicated constructs. (d) Representative photos of immunofluorescence staining of SIRT6 and ATM in U2OS cells, showing co-localization in the nucleus. Scale bar, 50 µm. (e) GST pull-down assay showing bacterially expressed His-SIRT6 predominantly bound to GST-ATM fragment 4 (770–1102), the N-terminal HEAT-repeat of ATM. (f) Immunoblots showing the increased binding capacity of ATM and SIRT6 under the treatment of (10 µM) CQ for the indicated time. (g) Immunoblots showing ATM and p-S/TQ in anti-Flag immunoprecipitates in HEK293 cells expressing Flag-SIRT6 treated with CPT (0.4 µM) or DMSO. (h) Immunoblots showing level of p-S/TQ SIRT6 in HEK293 cells co-transfected with HA-SIRT6 and Flag-ATM, Flag-ATM S1981A, or empty vector. (i) Immunoblots showing p-S/T Q SIRT6 in WT or ATM KO HEK293 cells. (j) Immunoblots showing p-S/T Q level of SIRT6 in ATM WT or KO HEK293 cells treated with DMSO and KU55933 (10 or 20 µM, 2 hr). (k) Alignment of protein sequence of human SIRT6 and orthologues in mouse, rat, fruit fly, Xenopus, and C. elegans. A conserved S¹¹² Q¹¹³ motif was highlighted. (l) Immunoblots showing p-S/T Q level of Flag-SIRT6, Flag-SIRT6 S112A, or Flag-SIRT6 S112D in HEK293 cells. (m) Quantitative RT-PCR analysis of mRNA levels of indicated glycolytic genes in sh-SIRT6 HepG2 cells re-expressing SIRT6, SIRT6 S112A, or 112D mutation. Data represent means ± SEM. *p<0.05, **p<0.01, ***p<0.001. ‘ns’ indicates no significant difference. (n) Immunoblots showing SIRT6 protein level in total cell extract (TCE) and chromatin-enriched fractions (P2). Densitometry analysis was performed to determine the relative ratio of SIRT6/H2B within chromatin fractions.

Figure 3—figure supplement 1.

Open in a separate window

ATM directly phosphorylates SIRT6.

(a) Immunoblots showing a significant increase in SIRT6 protein level, pS1981ATM, and pS824KAP-1 in the presence of DNA damage reagents-CPT and Dox in U2OS cells. (b) Immunoblots showing Sirt6 protein level in immortalized wild-type and Atm null MEFs in response to 0.4 μM CPT treatment. (c) Immunoblots showing pS1981-ATM and SIRT6 levels in wild-type and ATM KO HEK293 cells treated with CQ, low glucose (LG), and hypotonic swelling (20 mM NaCl). (d) Immunoblots of indicated immunoprecipitates showing the interaction between endogenous ATM and SIRT6 in HepG2 cells. (e) Immunoblots showing interaction between ATM and truncated fragments of SIRT6 in HEK293 cells. F-L, full-length of SIRT6, ΔC, C-terminal deletion, ΔN, N-terminal deletion, ΔN-C, N-and C-terminal truncation. (f) Immunoblots showing ATM protein in anti-Flag immunoprecipitates in HEK293 cells expressing Flag-SIRT6, treated with 0 μM, 4 μM, or 8 μM of CPT for 1 hr. (g) Immunoblots showing ATM protein in anti-HA immunoprecipitates in HEK293 cells expressing Flag-ATM or Flag-ATM S1981A, as well as empty vector or HA-SIRT6. (h) Immunoblots showing p-S/T Q of Flag-SIRT6 in HepG2 cells treated with 5 mM of glucose for indicated time. (i) Immunoblots showing p-S/T Q of Flag-SIRT6 in HEK293 cells, treated with or without λPP (30 min). (j) Immunoblots showing p-S/T Q of SIRT6 in WT and ATM KO HEK293 cells, transfected with empty vector, 2 μg Flag-ATM, or 6 μg Flag-ATM. (k) Immunoblots showing p-S/T Q of GST-SIRT6 after incubation with Flag-ATM purified from CPT-treated HEK293 cells. (l) Immunoblots showing SIRT6 protein levels in HepG2 cells with lentiviral infection containing sh-NC or sh-SIRT6.

We next examined whether ATM phosphorylates SIRT6. Firstly, we found that CQ or CPT treatment significantly enhanced the binding of SIRT6 to ATM (Figure 3f and Figure 3—figure supplement 1f), whereas the S1981A mutant blocked such association (Figure 3—figure supplement 1g). ATM preferentially phosphorylates the S/T-Q motif. In the presence of CPT, an increased p-S/TQ level of SIRT6 was identified (Figure 3g). Of note, lambda protein phosphatase (λPP) diminished the p-S/TQ level of SIRT6 (Figure 3—figure supplement 1h). Likewise, the p-S/TQ level of SIRT6 was elevated in cells treated with low glucose, which activates ATM by ROS generation (Assaily et al., 2011; Sarre et al., 2012) (Figure 3—figure supplement 1i). Moreover, ectopic ATM significantly increased the p-S/TQ level of SIRT6, but this was abolished in the case of S1981A mutant (Figure 3h). Consistently, a pronounced reduction of p-S/TQ level of SIRT6 was observed in cells lacking ATM or treated with KU55933, a selective and specific ATM kinase inhibitor (Berkovich et al., 2007; Hickson et al., 2004) (Figure 3i–j). The decrease in p-S/TQ level was primarily attributable to loss of ATM, as it was restored by ectopic FLAG-ATM in a dose-dependent manner (Figure 3—figure supplement 1j). Indeed, SIRT6 has one evolutionarily conserved S¹¹²Q¹¹³ motif (Figure 3k). We therefore constructed S112A and S112D mutants, which resemble hypo- and hyper-phosphorylated SIRT6 respectively. As shown, these mutations almost abolished the pS/T-Q level of FLAG-SIRT6 (Figure 3l). The in vitro kinase assay showed that ATM could phosphorylate GST-SIRT6, but not S112A (Figure 3—figure supplement 1k). Furthermore, compared with SIRT6 S112A, ectopic S112D exhibited a much higher inhibitory effect on glycolytic gene expression in sh-SIRT6 HepG2 cells (Figure 3m and Figure 3—figure supplement 1l), and enhanced chromatin association of SIRT6 (Figure 3n). Collectively, the data suggest that ATM directly phosphorylates SIRT6 at Serine 112.

We next examined whether ATM is involved in regulating SIRT6 protein stability. Notably, compared with WT or vehicle control, the degradation rate of ectopic and endogenous SIRT6 was largely increased in ATM KO HEK293 cells, Atm-/- MEFs, and cells incubated with KU55933 in the presence of cycloheximide (CHX) (Figure 4a–b and Figure 4—figure supplement 1a–c). Recently, MDM2 was demonstrated to ubiquitinate SIRT6 and promote its proteasomal degradation (Thirumurthi et al., 2014). We therefore examined the polyubiquitination level of SIRT6. As shown, the ubiquitination level of FLAG-SIRT6 in ATM KO cells was significantly elevated compared with WT (Figure 4—figure supplement 1d). While S112A mutant markedly enhanced the polyubiquitination level of SIRT6, S112D had little effect (Figure 4—figure supplement 1e). Moreover, S112A accelerated SIRT6 degradation, whereas S112D retarded it (Figure 4c–d), indicating that the Ser112 phosphorylation by ATM regulates SIRT6 ubiquitination and thus protein stability. Indeed, ectopic MDM2 enhanced the polyubiquitination level of FLAG-SIRT6 (Figure 4—figure supplement 1f). In the case of ATM depleted or SIRT6 S112A mutant, the binding capacity of SIRT6 to MDM2 was enhanced (Figure 4e and Figure 4—figure supplement 1g). In searching for key residues that are polyubiquitinated by MDM2, we identified two clusters of lysine residues, i.e. K143/145 and K346/349, which are conserved across species. We then generated KR mutations of these residues, and found that K346/349R remarkably reduced the polyubiquitination level of SIRT6 (Figure 4—figure supplement 1h). Individual KR mutation showed that K346R significantly blocked MDM2-mediated ubiquitination and degradation of SIRT6, whereas K349R hardly affected it (Figure 4f–g). More importantly, K346R restored the increased ubiquitination and accelerated protein degradation of SIRT6 S112A (Figure 4—figure supplement 1i–j). Collectively, these data indicate that K346 is subject to MDM2-mediated ubiquitination, which is inhibited by ATM-mediated S112 phosphorylation.

Open in a separate window

Figure 4.

ATM prevents ubiquitination and degradation of SIRT6.

(a) Immunoblots showing protein levels of Flag-SIRT6 in WT and ATM KO HEK293 cells treated with CHX (50 µg/ml) for indicated periods of time. (b) Quantification of protein levels in (a) by ImageJ. Data represent means ± SEM of three independent experiments. **p<0.01. (c) Immunoblots showing protein levels of Flag-SIRT6, S112A, and S112D in the presence of CHX (50 μg/ml) for indicated periods of time. (d) Quantification of protein levels in (c) by ImageJ. Data represent means ± SEM of three independent experiments. ***p<0.001. (e) Immunoblots showing increased binding capacity between SIRT6 and MDM2 in ATM KO HEK293 cells. (f) Immunoblots showing ubiquitination of Flag-SIRT6, K346R, K349R, and K346/349R (2KR) in HEK293 cells. Note that 2KR and K346R abrogated the ubiquitination of Flag-SIRT6. (g, h) Upper, immunoblots showing protein levels of Flag-SIRT6, K346R, and K349R in the presence of CHX (50 μg/ml) for indicated periods of time. Lower, quantification of protein levels by ImageJ. Data represent means ± SEM of three independent experiments. ***p<0.001.

Figure 4—figure supplement 1.

Open in a separate window

ATM-mediated phosphorylation of SIRT6 prevents its ubiquitination and degradation.

(a) Immunoblots showing Sirt6 levels in wild-type and Atm null MEFs in the presence of CHX (50 μg/ml). (b–c) Immunoblots showing SIRT6 protein level in HEK293 cells in the presence of CHX (50 μg/ml) and/or KU55933 (10 or 20 μM). Densitometry analysis was performed to determine the SIRT6/actin ratio. (d) Immunoblots showing increased ubiquitination of SIRT6 in ATM KO HEK293 cells. (e) Immunoblots showing ubiquitination of Flag-SIRT6, Flag-SIRT6 S112A, and Flag-SIRT6 S112D in HEK293 cells co-transfected Myc-Ub. (f) Immunoblots showing increased ubiquitination of Flag-SIRT6 in HEK293 cells overexpressing MDM2. (g) Immunoblots showing MDM2 in anti-Flag immunoprecipitates in HEK293 cells expressing Flag-SIRT6 or Flag-SIRT6 S112A. (h) Immunoblots showing ubiquitination of Flag-SIRT6, K143/145R, and K346/349R in HEK293 cells. Noted that K364/349R abrogated the ubiquitination of Flag-SIRT6. (i) Immunoblots showing the ubiquitination of Flag-SIRT6, Flag-SIRT6 S112A, and Flag-SIRT6 S112A/K346R. (j) Immunoblots showing protein levels of Flag-SIRT6, Flag-SIRT6 S112A, and Flag-SIRT6 S112A/K346R in the presence of CHX (50 μg/ml). Note that K346R rescued the accelerated degradation of S112A.

Mice

Zmpste24-/- mice and Atm-/- mice have been described previously (Barlow et al., 1996; Pendás et al., 2002). Sirt6-transgenic mice (Sirt6-tg) of C57BL/6J background were constructed by injecting cloned mSirt6 cDNA with CAG promoter into fertilized eggs. Primers for genotyping of Sirt6 transgenic allele were as follows: forward: 5’-CTGGTTATTGTGCTGTCTCATCAT-3’; reverse: 5’-CCGTCTACGTTCTGGCTGAC-3’. Atm-/- mice were crossed to Sirt6-tg mice to get Atm-/-;Sirt6-tg mice. Chloroquine (CQ) experiments were conducted as described (Schneider et al., 2006). Briefly, 12-month-old wild-type C57BL/6J male mice, 2-month-old Zmpste24-/-, and Atm-/- male mice were administered with CQ (Sigma, St. Louis, MO) in 0.9% saline twice per week at 7 mg/kg body weight, and the control group was treated with saline alone. At least 8 weeks after treatment of CQ, mice were subjected to functional tests. Body weight and lifespan was recorded. The survival rate was analyzed using the Kaplan–Meier method and statistical comparison was performed using the Log-rank Test. Mice were housed and handled in the laboratory animal research center of Shenzhen University. All experiments were performed in accordance with the guidelines of the Institutional Animal Care and Use Committee (IACUC). The protocols were approved by the Animal Welfare and Research Ethics Committee of Shenzhen University (Approval ID: 201412023).

C. elegans survival assay

C. elegans nematode survival assay was performed according to standard protocols (Kenyon et al., 1993). Briefly, wild-type and atm-1 null nematodes (100 to 150 per group) synchronized to prefertile young adult stage were exposed to NGM plates containing the indicated dosage of CQ. After 1-day incubation, animals were transferred to fresh incubation plates without CQ for another 2 days. This procedure was repeated every 3 days. Nematodes that showed no response to gentle stimulation were recorded as dead. The survival data were analyzed using the Kaplan–Meier method and statistical comparison was performed using the Log-rank Test.

Cell lines

HEK293 (CRL-1573), HepG2 (HB-8065), and U2OS (HTB-96) cells were purchased from ATCC. Human skin fibroblasts HSFs (F2-S) and primary MEFs were prepared as described previously (Liu et al., 2005). Immortalized Atm-/-; p53-/- and Sirt6-/- MEFs were provided as a kind gift from Dr. Yosef Shiloh (Tel Aviv University, Israel) and Dr. Raul Mostoslavsky (Massachusetts General Hospital Cancer center, USA), respectively. These cell lines were authenticated by short tandem repeat (STR) profile analysis and genotyping, and were mycoplasma free. Cells were cultured in Gibco DMEM (Life Technologies, USA) with 10% fetal bovine serum (FBS), 100 U/ml penicillin and streptomycin (P/S) at 37°C in 5% CO₂ and atmospheric oxygen conditions. For CQ experiments, cells were maintained in the medium containing 1 μM chloroquine for 12 hr, and then grown in new fresh medium for 48 hr.

Plasmids

Human Flag-SIRT6, pcDNA3.1 Flag-ATM, Flag-ATM S1981A, and pcDNA3 human MDM2 were all purchased from Addgene (Cambridge, MA). Flag-SIRT6 with amino acid substitution mutations (S112A, S112D, K346R/K349R) were generated by PCR-based mutagenesis using pcDNA3-Flag-SIRT6 as a template and a QuikChange II site-directed mutagenesis kit (Agilent Technologies), following the manufacturer’s instructions. Primer sequences for amino acid mutations of SIRT6 were as follows: SIRT6 S112A: (forward) 5'-cgtccacgttctgggcgaccaggaagcgga-3', (reverse) 5’-tccgcttcctggtcgcccagaacgtggacg-3’; SIRT6 S112D: (forward) 5'-ccgtccacgttctggtcgaccaggaagcggag-3', (reverse) 5'-ctccgcttcctggtcgaccagaacgtggacgg-3'; SIRT6 K346R: (forward) 5'-ggccttcacccttctggggggtctgtg-3', (reverse) 5'-cacagaccccccagaagggtgaaggcc-3'; SIRT6 K349R: (forward) 5'-gccttggccctcacccttttggggggt-3', (reverse) 5'-accccccaaaagggtgagggccaaggc-3. HA-tagged human SIRT6 plasmid was amplified from the respective cDNAs and constructed into pKH3-HA vector. To express four truncated forms of SIRT6 protein, HA-SIRT6 plasmid as a template was constructed by PCR-based deletion.

Protein extraction and western blotting

For whole cell protein extraction, cells were suspended in five volumes of suspension buffer (20 mM Tris-HCl, pH 7.5, 150 mM NaCl, 1 mM EDTA, 1 mM DTT, protease inhibitor cocktail), and then five volumes of 2X SDS loading buffer were added and incubated at 98°C for 6 min. Mice tissues were homogenized with 1 ml of ice-cold tissue lysis buffer (25 mM TrisHCl, pH 7.5, 10 mM Na₃VO₄, 100 mM NaF, 50 mM Na₄P₂O₇, 5 mM EGTA, 5 mM EDTA, 0.5% SDS, 1% NP-40, protease inhibitor cocktail). After homogenization and sonication, lysates were centrifuged at 16,000 g for 15 min. The clean supernatant was carefully transferred to new tubes. Protein concentrations were determined using a bicinchoninic acid (BCA) assay method (Pierce, Rockford, IL) and were normalized with lysis buffer for each sample. Samples were denatured in 1X SDS loading buffer by boiling at 98°C for 6 min. Proteins were separated by loading to SDS-polyacrylamide gels, and then were transferred to PVDF membrane (Millipore). The protein levels were determined by immunoblotting using respective antibodies. The ImageJ program was used for densitometric analysis of immunoblotting, and the quantification results were normalized to the loading control.

Antibodies

Rabbit anti-SIRT6 (ab62739), ATM (ab78), SIRT1 (ab12193), γH2AX (ab81299), RAP80 (ab52893), Kap-1 (ab10484), and p-KAP-1 (Ser824, ab70369) antibodies were obtained from Abcam (Cambridge, UK). Anti-lamin A/C (sc-20681), p21 (sc-6246), MDM2 (sc-965), and P53 (sc-6243) antibodies were purchased from Santa Cruz Biotechnology. Rabbit anti-γH2AX (05–636), p-ATM (Ser1981) (05–740), histone H3 (07–690), anti-H3K56ac (07–677), and H3K9ac (07–352) antibodies were sourced from EMD Millipore. Mouse anti-p-ATM (Ser1981) (#5883), p-S/TQ (#9607), ubiquitin (#3936), and cleaved caspase-3 (#9661) antibodies were purchased from Cell Signaling Technology (Beverly, MA). Mouse anti- HA, Flag, rabbit anti-LC3B, and P62 antibodies were obtained from Sigma-Aldrich. Anti-Nbs1 (NB100-143) antibody was purchased from Novus Biologicals. Mouse anti-actin, tubulin antibodies were obtained from Beyotime. Anti-pS112 SIRT6 monoclonal antibodies were prepared by Abmart generated from a specific phosphorylated peptide (peptide sequence CLRFVS_PQNV).

Protein degradation assay

HEK293 cells (WT and ATM-deficient cells) were transfected with Flag-SIRT6 alone or together with Mdm2. 48 hr later, the cells were treated with 50 μg/ml of cycloheximide (CHX, Sigma-Aldrich), a translation inhibitor. For endogenous SIRT6 protein degradation assay, ATM wild-type and null MEFs were grown in 6 cm plates, and were treated with 50 mg/ml CHX for indicated time points. Cells were collected and the protein levels were determined by western blotting, the subsequent quantification was performed with ImageJ software.

In vivo ubiquitination assay

In vivo ubiquitination assay was performed by transfecting HEK293 cells in 6 cm dishes with 1 μg Myc-ubiquitin, 2 μg Flag-SIRT6 or its mutations, and/or 1 μg MDM2 vector. 48 hr after transfection, cells were lysed in the buffer (25 mM Tris-HCl pH 8.0, 250 mM NaCl, 10 mM Na₃VO₄, 1 mM EDTA, 10% glycerol, protease inhibitor cocktail, and 0.1 mM phenylmethylsulphonyl fluoride), and then incubated with Flag-M2 beads (Sigma-Aldrich) overnight at 4°C. Beads were washed with lysis buffer three times, bound proteins were eluted by adding 1.5 × SDS loading buffer. The ubiquitin levels were analyzed by immunoblotting.

In vitro kinase assay

HEK293T cells were transfected with 10 μg of FLAG-ATM and then treated with CPT. Activated ATM was immune-purified from the cell extracts with FLAG beads (Sigma, M8823). GST-SIRT6 or the S112A mutant was purified from bacteria. Kinase reactions were initiated by incubating purified ATM with GST-SIRT6 in the kinase buffer with or without 1 mM ATP for 120 min at 30°C. After reaction, proteins were blocked by SDS loading buffer. The membrane was then subjected to western blotting with antibodies against p-S/TQ.

Immunoprecipitation

Cells under indicated treatments were totally lysed in lysis buffer containing 20 mM HEPES, pH 7.5, 150 mM NaCl, 10 mM Na₃VO₄, 10% glycerol, 2 mM EDTA, protease inhibitor cocktail, and 0.1 mM phenylmethylsulphonyl fluoride. After sonication and centrifugation, the supernatant was collected and incubated with H3K9ac (Millipore, 2 μg/sample) overnight at 4°C with a gentle rotation. Protein A/G agarose (Pierce, 10 μl/sample) were added to the tubes and rotated at 4°C for 2 hr. Beads were precipitated by centrifugation at 1000 g for 15 s and washed three times with cold lysis buffer. The pellet was resuspended in 1.5 × SDS loading buffer and incubated at 98°C for 6 min. The supernatants were collected and used for western blotting.

GST pull-down assay

A series of GST fusion proteins of truncated ATM, which together spanned the full length of ATM, were constructed into pGEX4T-3 vector. For GST pull-down, bacterially expressed 6 × His tagged SIRT6 was separately incubated with various GST-ATM fragments in a buffer of 150 mM NaCl, 20 mM Tris-HCl [pH 7.5], 5 mM MgCl₂, 0.2 mM EDTA, 10% glycerol, 0.2% NP-40, and protease inhibitors (Roche Complete). GST-fusion proteins were then precipitated by adding Glutathione Sepharose fast flow (GE Healthcare). After washing twice with TEN buffer (0.5% Nonidet P-40, 20 mM Tris-HCl [pH 7.4], 0.1 mM EDTA, and 300 mM NaCl), glutathione agarose beads were analyzed by western blotting and coomassie staining.

RNA interference and shRNA lentiviral infection

Briefly, cells were transfected with small interfering RNAs (siRNAs) for 48 hr using Lipofectamine 3000 (Invitrogen, USA) according to the manufacturer’s instructions. The siRNAs targeting human ATM, SIRT6, and HDM2 were purchased (GenePharma, China) with sequences as follows, si-ATM#1: 5’-AAUGUCUUUGAGUAGUAUGUU-3’ (Zhou et al., 2003); Si-ATM#2: 5’-AAGCACCAGUCCAGUAUUGGC-3’ (Zhang et al., 2005); si-SIRT6#1: 5’-AAGAAUGUGCCAAGUGUAAGA-3’; si-SIRT6#2: 5’-CCGGCTCTGCACCGTGGCTAA-3’; si-HDM2#1: 5’-AACGCCACAAATCTGATAGTA-3’; si-HDM2#2: 5’-AATGCCTCAATTCACATAGAT-3’. A scrambled siRNA sequence was used as control. Lentiviral shRNA constructs were generated in a pGLVH1 backbone (GenePharma, China), and virus was produced in HEK293 cells. To deplete ATM in HSF cells and SIRT6 in HepG2 cells, lentiviral infection was performed in the presence of 5 μg/ml polybrene. Two days later, the infected HSF cells or HepG2 cells were selected with 2 μg/ml puromycin. To downregulate sir-2.4 expression, the NL2099 worms were exposed to incubation plates containing HT115 bacteria with sir-2.4 RNAi vector.

CRISPR/Cas9-mediated genome editing

Gene mutagenesis by the CRISPR/Cas9 system was conducted as described (Ran et al., 2013). The following gRNAs targeting human ATM, SIRT6 were constructed in pX459 vector (Addgene, #48139). sgATM F: 5’-CACCGATATGTGTTACGATGCCTTA-3’, R: 5’- AAACTAAGGCATCGTAACACATATC-3’. HEK293 cells were transfected with pX459 or pX459-gRNA using Lipofetamine 3000 Transfection Reagent according to the manufacturer's instructions. After 2-day culture, cells were selected with 2 μg/ml puromycin, six colonies were picked and grown to establish stable cell lines. The targeted mutations were identified by western blotting, and PCR-based sequencing.

EdU (5-ethynyl-2’-deoxyuridine) incorporation assay

EdU incorporation assays were conducted in HSF cells to estimate cell proliferation using the Click-iT EdU Alexa Fluor 488 Kit (Invitrogen, USA). HSF cells, infected by the respective lentiviruses containing shNC and shATM, were cultured in a six-well plate containing the coverslips in the presence of 10 μM EdU for 12 hr. Cells were fixed in 3.7% formaldehyde followed by 0.5% Triton X-100 permeabilization, and then stained with Alexa Fluor picolyl azide. Five random views were captured to calculate the positive staining rate for each group.

Growth curves and SA-β-gal assays

Cell population doublings were monitored using a Coulter Counter. SA-β-galactosidase assay in primary cells was performed using Senescence β-galactosidase staining Kit (#9860, CST) according to the manufacturer's instructions. Five views were captured randomly to calculate the positive staining rate for each group.

RNA preparation and Real-Time qPCR

Total RNA was extracted from cells or mouse tissues using Trizol reagent RNAiso Plus (TaKaRa, Japan) following the phenol–chloroform extraction method. Purified total RNA was used to obtain cDNA using PrimeScript RT Master Mix (Takara, Japan) following this method: 37°C for 30 min, and 85°C for 5 s. The gene expression was analyzed with the CFX Connected Real-Time PCR Detection System (BioRad) with SYBR Ex Taq Premixes (Takara, Japan). Gene expression levels were normalized to actin.

Glucose tolerance test

Mice were fasted overnight (6 p.m. to 9 a.m.), and D-glucose (2.5 g/kg body weight) was administrated intraperitoneally. Blood glucose levels were determined from tail vein blood using a glucometer (Onetouch ultravue, Johnson, USA) at 0, 30, 60, 90, and 120 min after D-glucose injection.

Insulin tolerance test

Mice were fasted for 6 hr (8 a.m. to 2 p.m.), and recombinant human insulin (0.75 U/kg body weight) was administered intraperitoneally. Blood glucose levels were determined in tail vein blood using a glucometer (Onetouch ultravue, Johnson) at 0, 30, 60, 90, and 120 min after insulin injection.

Lactate assay

Mouse serum was five-fold diluted, and lactate concentration was determined with the Lactate Colorimetric Assay Kit (BioVision).

Endurance running test

Zmpste24-/- mice were treated for 8 weeks with chloroquine or saline before running on a Rota-Rod Treadmill (YLS-4C, Jinan Yiyan Scientific Research Company, Shandong, China) to test the effect of chloroquine on fatigue resistance. Mice were placed on the rotating lane, and the speed was gradually increased to 10 r/min. When mice were exhausted and safely dropped from the rotating lane, the time latency to fall was automatically recorded.

Metabolite analysis

Wild-type and ATM KO cells were grown in normal medium for 24 hr, and methanol-fixed cell pellets were analyzed by a two liquid chromatography-tandem mass spectrometry (LC-MS) method as described (Luo et al., 2007).

Immunofluorescence microscopy

The cells were fixed using 4% paraformaldehyde at room temperature for 15 min, permeabilized by 0.5% Triton X-100 at room temperature for 10 min, blocked using 10% FBS/PBS, and then incubated with primary antibodies diluted in PBS containing 2% BSA overnight at 4°C. The primary antibodies were detected using an Alexa-488-conjugated anti-mouse secondary antibody (Invitrogen). The nuclei were stained using DAPI in anti-fade mounting medium. Images were captured using a Zeiss LSM880 confocal/multiphoton microscope.

ChIP assay

Cells were fixed in 1% formaldehyde for 10 min at room temperature. The crosslinking reaction was quenched with 0.125 M glycine. After washing with PBS, cells were lysed with lysis buffer (50 mM Tris·HCl pH 8.0, 2 mM EDTA, 15 mM NaCl, 1% SDS, 0.5% deoxycholate, protease inhibitor cocktail, 1 mM PMSF), followed by sonication and centrifugation. The supernatant was collected and precleared in dilution buffer (50 mM Tris-HCl pH 8.0, 2 mM EDTA, 150 mM NaCl, 1% Triton X-100) with protein A/G Sepharose and pre-treated salmon DNA. The precleared samples were incubated overnight with H3K9ac antibody (2 μg/sample, Millipore) or appropriate control IgGs (Santa Cruz), and protein A/G Sepharose (Invitrogen). After washing sequentially with a series of buffers, the beads were heated at 65°C to reverse the crosslink. DNA fragments were purified and analyzed. Real-time PCR was performed with primers as described (Zhong et al., 2010):

LDHB-ChIP-5’: AGAGAGAGCGCTTCGCATAG

LDHB-ChIP-3’: GGCTGGATGAGACAAAGAGC

ALDOC-ChIP-5’: AAGTGGGGCACTGTTAGGTG

ALDOC-ChIP-3’: GTTGGGGATTAAGCCTGGTT

PFKM-ChIP-5’: TTAAGACAAAGCCTGGCACA

PFKM-ChIP-3’: CAACCACAGCAATTGACCAC

LDHA-ChIP-5’: AGGGGGTGTGTGAAAACAAG

LDHA-ChIP-3’: ATGGCTTGCCAGCTTACATC

LDHA-ChIP-1Kb-5’: TGCAAGACAAGTGTCCCTGT

LDHA-ChIP-1Kb-3’: GAGGGAATGAAGCTCACAGC

We thank Dr. Yosef Shiloh (Tel Aviv University, Israel) for Atm-/-; p53-/- MEF cells and Dr. Raul Mostoslavsky (Massachusetts General Hospital Cancer center, USA) for Sirt6-/- MEFs. This project is supported by research grants from the National Natural Science Foundation of China (81422016, 91439133, 81571374, 81501206, 81501210), National Key R and D Program of China (2017YFA0503900, 2016YFC0904600), Research Grant Council of Hong Kong (773313, HKU2/CRF/13G), Natural Science Foundation of Guangdong Province (2014A030308011, 2015A030308007, 2016A030310064) and Shenzhen Science and Technology Innovation Commission (CXZZ20140903103747568, JCYJ20160226191451487 and JCYJ20140418095735645) and Discipline Construction Funding of Shenzhen (2016).